ID: 1176709205

View in Genome Browser
Species Human (GRCh38)
Location 21:10135222-10135244
Sequence AGCCCACTGGGGTCCTGCGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176709201_1176709205 2 Left 1176709201 21:10135197-10135219 CCTATGGGGAGGATGAGCAGTCA No data
Right 1176709205 21:10135222-10135244 AGCCCACTGGGGTCCTGCGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176709205 Original CRISPR AGCCCACTGGGGTCCTGCGT AGG Intergenic
No off target data available for this crispr