ID: 1176714353

View in Genome Browser
Species Human (GRCh38)
Location 21:10337237-10337259
Sequence CGGGTCAGCAAACCAGTTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176714348_1176714353 16 Left 1176714348 21:10337198-10337220 CCTCCTGACAAGAAGGTCAGGAA No data
Right 1176714353 21:10337237-10337259 CGGGTCAGCAAACCAGTTCCAGG No data
1176714349_1176714353 13 Left 1176714349 21:10337201-10337223 CCTGACAAGAAGGTCAGGAATTC No data
Right 1176714353 21:10337237-10337259 CGGGTCAGCAAACCAGTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176714353 Original CRISPR CGGGTCAGCAAACCAGTTCC AGG Intergenic
No off target data available for this crispr