ID: 1176718517

View in Genome Browser
Species Human (GRCh38)
Location 21:10374610-10374632
Sequence CCTTACATGGTAAAGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176718517_1176718524 12 Left 1176718517 21:10374610-10374632 CCTTCCACCTTTACCATGTAAGG No data
Right 1176718524 21:10374645-10374667 TTCCTTCTGGAAGATTTAGCAGG No data
1176718517_1176718527 27 Left 1176718517 21:10374610-10374632 CCTTCCACCTTTACCATGTAAGG No data
Right 1176718527 21:10374660-10374682 TTAGCAGGAAGGTGCCATCTTGG No data
1176718517_1176718528 30 Left 1176718517 21:10374610-10374632 CCTTCCACCTTTACCATGTAAGG No data
Right 1176718528 21:10374663-10374685 GCAGGAAGGTGCCATCTTGGAGG No data
1176718517_1176718526 16 Left 1176718517 21:10374610-10374632 CCTTCCACCTTTACCATGTAAGG No data
Right 1176718526 21:10374649-10374671 TTCTGGAAGATTTAGCAGGAAGG No data
1176718517_1176718523 -1 Left 1176718517 21:10374610-10374632 CCTTCCACCTTTACCATGTAAGG No data
Right 1176718523 21:10374632-10374654 GACAAGGTGTGTCTTCCTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176718517 Original CRISPR CCTTACATGGTAAAGGTGGA AGG (reversed) Intergenic
No off target data available for this crispr