ID: 1176718824

View in Genome Browser
Species Human (GRCh38)
Location 21:10377298-10377320
Sequence CAGACATATCACCTGGGGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176718824_1176718833 8 Left 1176718824 21:10377298-10377320 CCTGACCCCAGGTGATATGTCTG No data
Right 1176718833 21:10377329-10377351 TCCCAAAGTGTTGGGATGACAGG No data
1176718824_1176718831 0 Left 1176718824 21:10377298-10377320 CCTGACCCCAGGTGATATGTCTG No data
Right 1176718831 21:10377321-10377343 CCTTGGCCTCCCAAAGTGTTGGG No data
1176718824_1176718836 27 Left 1176718824 21:10377298-10377320 CCTGACCCCAGGTGATATGTCTG No data
Right 1176718836 21:10377348-10377370 CAGGTGTGAGCCACTGTGCTCGG No data
1176718824_1176718829 -1 Left 1176718824 21:10377298-10377320 CCTGACCCCAGGTGATATGTCTG No data
Right 1176718829 21:10377320-10377342 GCCTTGGCCTCCCAAAGTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176718824 Original CRISPR CAGACATATCACCTGGGGTC AGG (reversed) Intergenic