ID: 1176718825

View in Genome Browser
Species Human (GRCh38)
Location 21:10377303-10377325
Sequence CAAGGCAGACATATCACCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176718825_1176718833 3 Left 1176718825 21:10377303-10377325 CCCCAGGTGATATGTCTGCCTTG No data
Right 1176718833 21:10377329-10377351 TCCCAAAGTGTTGGGATGACAGG 0: 215
1: 25122
2: 318955
3: 254659
4: 134873
1176718825_1176718836 22 Left 1176718825 21:10377303-10377325 CCCCAGGTGATATGTCTGCCTTG No data
Right 1176718836 21:10377348-10377370 CAGGTGTGAGCCACTGTGCTCGG 0: 308
1: 7224
2: 29219
3: 75558
4: 130919
1176718825_1176718831 -5 Left 1176718825 21:10377303-10377325 CCCCAGGTGATATGTCTGCCTTG No data
Right 1176718831 21:10377321-10377343 CCTTGGCCTCCCAAAGTGTTGGG 0: 6703
1: 100902
2: 223602
3: 235479
4: 140081
1176718825_1176718829 -6 Left 1176718825 21:10377303-10377325 CCCCAGGTGATATGTCTGCCTTG No data
Right 1176718829 21:10377320-10377342 GCCTTGGCCTCCCAAAGTGTTGG 0: 4241
1: 65643
2: 179729
3: 221520
4: 168807

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176718825 Original CRISPR CAAGGCAGACATATCACCTG GGG (reversed) Intergenic
No off target data available for this crispr