ID: 1176718829

View in Genome Browser
Species Human (GRCh38)
Location 21:10377320-10377342
Sequence GCCTTGGCCTCCCAAAGTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 639940
Summary {0: 4241, 1: 65643, 2: 179729, 3: 221520, 4: 168807}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176718822_1176718829 13 Left 1176718822 21:10377284-10377306 CCTCGTCTTGAACTCCTGACCCC No data
Right 1176718829 21:10377320-10377342 GCCTTGGCCTCCCAAAGTGTTGG 0: 4241
1: 65643
2: 179729
3: 221520
4: 168807
1176718821_1176718829 26 Left 1176718821 21:10377271-10377293 CCGTGTTGGTCAGCCTCGTCTTG No data
Right 1176718829 21:10377320-10377342 GCCTTGGCCTCCCAAAGTGTTGG 0: 4241
1: 65643
2: 179729
3: 221520
4: 168807
1176718825_1176718829 -6 Left 1176718825 21:10377303-10377325 CCCCAGGTGATATGTCTGCCTTG No data
Right 1176718829 21:10377320-10377342 GCCTTGGCCTCCCAAAGTGTTGG 0: 4241
1: 65643
2: 179729
3: 221520
4: 168807
1176718826_1176718829 -7 Left 1176718826 21:10377304-10377326 CCCAGGTGATATGTCTGCCTTGG No data
Right 1176718829 21:10377320-10377342 GCCTTGGCCTCCCAAAGTGTTGG 0: 4241
1: 65643
2: 179729
3: 221520
4: 168807
1176718824_1176718829 -1 Left 1176718824 21:10377298-10377320 CCTGACCCCAGGTGATATGTCTG No data
Right 1176718829 21:10377320-10377342 GCCTTGGCCTCCCAAAGTGTTGG 0: 4241
1: 65643
2: 179729
3: 221520
4: 168807
1176718828_1176718829 -8 Left 1176718828 21:10377305-10377327 CCAGGTGATATGTCTGCCTTGGC No data
Right 1176718829 21:10377320-10377342 GCCTTGGCCTCCCAAAGTGTTGG 0: 4241
1: 65643
2: 179729
3: 221520
4: 168807

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176718829 Original CRISPR GCCTTGGCCTCCCAAAGTGT TGG Intergenic
Too many off-targets to display for this crispr