ID: 1176718830

View in Genome Browser
Species Human (GRCh38)
Location 21:10377321-10377343
Sequence CCCAACACTTTGGGAGGCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 697519
Summary {0: 6346, 1: 95043, 2: 216067, 3: 233638, 4: 146425}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176718830_1176718836 4 Left 1176718830 21:10377321-10377343 CCTTGGCCTCCCAAAGTGTTGGG 0: 6346
1: 95043
2: 216067
3: 233638
4: 146425
Right 1176718836 21:10377348-10377370 CAGGTGTGAGCCACTGTGCTCGG 0: 308
1: 7224
2: 29219
3: 75558
4: 130919
1176718830_1176718838 22 Left 1176718830 21:10377321-10377343 CCTTGGCCTCCCAAAGTGTTGGG 0: 6346
1: 95043
2: 216067
3: 233638
4: 146425
Right 1176718838 21:10377366-10377388 CTCGGCCAACCCTTGAATTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176718830 Original CRISPR CCCAACACTTTGGGAGGCCA AGG (reversed) Intergenic
Too many off-targets to display for this crispr