ID: 1176718831

View in Genome Browser
Species Human (GRCh38)
Location 21:10377321-10377343
Sequence CCTTGGCCTCCCAAAGTGTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 706767
Summary {0: 6703, 1: 100902, 2: 223602, 3: 235479, 4: 140081}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176718822_1176718831 14 Left 1176718822 21:10377284-10377306 CCTCGTCTTGAACTCCTGACCCC No data
Right 1176718831 21:10377321-10377343 CCTTGGCCTCCCAAAGTGTTGGG 0: 6703
1: 100902
2: 223602
3: 235479
4: 140081
1176718824_1176718831 0 Left 1176718824 21:10377298-10377320 CCTGACCCCAGGTGATATGTCTG No data
Right 1176718831 21:10377321-10377343 CCTTGGCCTCCCAAAGTGTTGGG 0: 6703
1: 100902
2: 223602
3: 235479
4: 140081
1176718825_1176718831 -5 Left 1176718825 21:10377303-10377325 CCCCAGGTGATATGTCTGCCTTG No data
Right 1176718831 21:10377321-10377343 CCTTGGCCTCCCAAAGTGTTGGG 0: 6703
1: 100902
2: 223602
3: 235479
4: 140081
1176718821_1176718831 27 Left 1176718821 21:10377271-10377293 CCGTGTTGGTCAGCCTCGTCTTG No data
Right 1176718831 21:10377321-10377343 CCTTGGCCTCCCAAAGTGTTGGG 0: 6703
1: 100902
2: 223602
3: 235479
4: 140081
1176718828_1176718831 -7 Left 1176718828 21:10377305-10377327 CCAGGTGATATGTCTGCCTTGGC No data
Right 1176718831 21:10377321-10377343 CCTTGGCCTCCCAAAGTGTTGGG 0: 6703
1: 100902
2: 223602
3: 235479
4: 140081
1176718826_1176718831 -6 Left 1176718826 21:10377304-10377326 CCCAGGTGATATGTCTGCCTTGG No data
Right 1176718831 21:10377321-10377343 CCTTGGCCTCCCAAAGTGTTGGG 0: 6703
1: 100902
2: 223602
3: 235479
4: 140081

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176718831 Original CRISPR CCTTGGCCTCCCAAAGTGTT GGG Intergenic
Too many off-targets to display for this crispr