ID: 1176718832

View in Genome Browser
Species Human (GRCh38)
Location 21:10377327-10377349
Sequence TGTCATCCCAACACTTTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 744258
Summary {0: 215, 1: 24438, 2: 322405, 3: 259418, 4: 137782}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176718832_1176718838 16 Left 1176718832 21:10377327-10377349 CCTCCCAAAGTGTTGGGATGACA 0: 215
1: 24438
2: 322405
3: 259418
4: 137782
Right 1176718838 21:10377366-10377388 CTCGGCCAACCCTTGAATTTAGG No data
1176718832_1176718836 -2 Left 1176718832 21:10377327-10377349 CCTCCCAAAGTGTTGGGATGACA 0: 215
1: 24438
2: 322405
3: 259418
4: 137782
Right 1176718836 21:10377348-10377370 CAGGTGTGAGCCACTGTGCTCGG 0: 308
1: 7224
2: 29219
3: 75558
4: 130919

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176718832 Original CRISPR TGTCATCCCAACACTTTGGG AGG (reversed) Intergenic
Too many off-targets to display for this crispr