ID: 1176718833

View in Genome Browser
Species Human (GRCh38)
Location 21:10377329-10377351
Sequence TCCCAAAGTGTTGGGATGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 733824
Summary {0: 215, 1: 25122, 2: 318955, 3: 254659, 4: 134873}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176718822_1176718833 22 Left 1176718822 21:10377284-10377306 CCTCGTCTTGAACTCCTGACCCC No data
Right 1176718833 21:10377329-10377351 TCCCAAAGTGTTGGGATGACAGG 0: 215
1: 25122
2: 318955
3: 254659
4: 134873
1176718825_1176718833 3 Left 1176718825 21:10377303-10377325 CCCCAGGTGATATGTCTGCCTTG No data
Right 1176718833 21:10377329-10377351 TCCCAAAGTGTTGGGATGACAGG 0: 215
1: 25122
2: 318955
3: 254659
4: 134873
1176718826_1176718833 2 Left 1176718826 21:10377304-10377326 CCCAGGTGATATGTCTGCCTTGG No data
Right 1176718833 21:10377329-10377351 TCCCAAAGTGTTGGGATGACAGG 0: 215
1: 25122
2: 318955
3: 254659
4: 134873
1176718824_1176718833 8 Left 1176718824 21:10377298-10377320 CCTGACCCCAGGTGATATGTCTG No data
Right 1176718833 21:10377329-10377351 TCCCAAAGTGTTGGGATGACAGG 0: 215
1: 25122
2: 318955
3: 254659
4: 134873
1176718828_1176718833 1 Left 1176718828 21:10377305-10377327 CCAGGTGATATGTCTGCCTTGGC No data
Right 1176718833 21:10377329-10377351 TCCCAAAGTGTTGGGATGACAGG 0: 215
1: 25122
2: 318955
3: 254659
4: 134873

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176718833 Original CRISPR TCCCAAAGTGTTGGGATGAC AGG Intergenic
Too many off-targets to display for this crispr