ID: 1176718834

View in Genome Browser
Species Human (GRCh38)
Location 21:10377330-10377352
Sequence ACCTGTCATCCCAACACTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 666185
Summary {0: 55, 1: 6642, 2: 101702, 3: 325001, 4: 232785}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176718834_1176718838 13 Left 1176718834 21:10377330-10377352 CCCAAAGTGTTGGGATGACAGGT 0: 55
1: 6642
2: 101702
3: 325001
4: 232785
Right 1176718838 21:10377366-10377388 CTCGGCCAACCCTTGAATTTAGG No data
1176718834_1176718836 -5 Left 1176718834 21:10377330-10377352 CCCAAAGTGTTGGGATGACAGGT 0: 55
1: 6642
2: 101702
3: 325001
4: 232785
Right 1176718836 21:10377348-10377370 CAGGTGTGAGCCACTGTGCTCGG 0: 308
1: 7224
2: 29219
3: 75558
4: 130919

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176718834 Original CRISPR ACCTGTCATCCCAACACTTT GGG (reversed) Intergenic
Too many off-targets to display for this crispr