ID: 1176718835

View in Genome Browser
Species Human (GRCh38)
Location 21:10377331-10377353
Sequence CACCTGTCATCCCAACACTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 573624
Summary {0: 53, 1: 6289, 2: 90204, 3: 224869, 4: 252209}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176718835_1176718836 -6 Left 1176718835 21:10377331-10377353 CCAAAGTGTTGGGATGACAGGTG 0: 53
1: 6289
2: 90204
3: 224869
4: 252209
Right 1176718836 21:10377348-10377370 CAGGTGTGAGCCACTGTGCTCGG 0: 308
1: 7224
2: 29219
3: 75558
4: 130919
1176718835_1176718838 12 Left 1176718835 21:10377331-10377353 CCAAAGTGTTGGGATGACAGGTG 0: 53
1: 6289
2: 90204
3: 224869
4: 252209
Right 1176718838 21:10377366-10377388 CTCGGCCAACCCTTGAATTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176718835 Original CRISPR CACCTGTCATCCCAACACTT TGG (reversed) Intergenic
Too many off-targets to display for this crispr