ID: 1176718836

View in Genome Browser
Species Human (GRCh38)
Location 21:10377348-10377370
Sequence CAGGTGTGAGCCACTGTGCT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 243228
Summary {0: 308, 1: 7224, 2: 29219, 3: 75558, 4: 130919}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176718826_1176718836 21 Left 1176718826 21:10377304-10377326 CCCAGGTGATATGTCTGCCTTGG No data
Right 1176718836 21:10377348-10377370 CAGGTGTGAGCCACTGTGCTCGG 0: 308
1: 7224
2: 29219
3: 75558
4: 130919
1176718828_1176718836 20 Left 1176718828 21:10377305-10377327 CCAGGTGATATGTCTGCCTTGGC No data
Right 1176718836 21:10377348-10377370 CAGGTGTGAGCCACTGTGCTCGG 0: 308
1: 7224
2: 29219
3: 75558
4: 130919
1176718825_1176718836 22 Left 1176718825 21:10377303-10377325 CCCCAGGTGATATGTCTGCCTTG No data
Right 1176718836 21:10377348-10377370 CAGGTGTGAGCCACTGTGCTCGG 0: 308
1: 7224
2: 29219
3: 75558
4: 130919
1176718832_1176718836 -2 Left 1176718832 21:10377327-10377349 CCTCCCAAAGTGTTGGGATGACA 0: 215
1: 24438
2: 322405
3: 259418
4: 137782
Right 1176718836 21:10377348-10377370 CAGGTGTGAGCCACTGTGCTCGG 0: 308
1: 7224
2: 29219
3: 75558
4: 130919
1176718830_1176718836 4 Left 1176718830 21:10377321-10377343 CCTTGGCCTCCCAAAGTGTTGGG 0: 6346
1: 95043
2: 216067
3: 233638
4: 146425
Right 1176718836 21:10377348-10377370 CAGGTGTGAGCCACTGTGCTCGG 0: 308
1: 7224
2: 29219
3: 75558
4: 130919
1176718835_1176718836 -6 Left 1176718835 21:10377331-10377353 CCAAAGTGTTGGGATGACAGGTG 0: 53
1: 6289
2: 90204
3: 224869
4: 252209
Right 1176718836 21:10377348-10377370 CAGGTGTGAGCCACTGTGCTCGG 0: 308
1: 7224
2: 29219
3: 75558
4: 130919
1176718834_1176718836 -5 Left 1176718834 21:10377330-10377352 CCCAAAGTGTTGGGATGACAGGT 0: 55
1: 6642
2: 101702
3: 325001
4: 232785
Right 1176718836 21:10377348-10377370 CAGGTGTGAGCCACTGTGCTCGG 0: 308
1: 7224
2: 29219
3: 75558
4: 130919
1176718824_1176718836 27 Left 1176718824 21:10377298-10377320 CCTGACCCCAGGTGATATGTCTG No data
Right 1176718836 21:10377348-10377370 CAGGTGTGAGCCACTGTGCTCGG 0: 308
1: 7224
2: 29219
3: 75558
4: 130919

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176718836 Original CRISPR CAGGTGTGAGCCACTGTGCT CGG Intergenic
Too many off-targets to display for this crispr