ID: 1176718838

View in Genome Browser
Species Human (GRCh38)
Location 21:10377366-10377388
Sequence CTCGGCCAACCCTTGAATTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176718835_1176718838 12 Left 1176718835 21:10377331-10377353 CCAAAGTGTTGGGATGACAGGTG 0: 53
1: 6289
2: 90204
3: 224869
4: 252209
Right 1176718838 21:10377366-10377388 CTCGGCCAACCCTTGAATTTAGG No data
1176718832_1176718838 16 Left 1176718832 21:10377327-10377349 CCTCCCAAAGTGTTGGGATGACA 0: 215
1: 24438
2: 322405
3: 259418
4: 137782
Right 1176718838 21:10377366-10377388 CTCGGCCAACCCTTGAATTTAGG No data
1176718830_1176718838 22 Left 1176718830 21:10377321-10377343 CCTTGGCCTCCCAAAGTGTTGGG 0: 6346
1: 95043
2: 216067
3: 233638
4: 146425
Right 1176718838 21:10377366-10377388 CTCGGCCAACCCTTGAATTTAGG No data
1176718834_1176718838 13 Left 1176718834 21:10377330-10377352 CCCAAAGTGTTGGGATGACAGGT 0: 55
1: 6642
2: 101702
3: 325001
4: 232785
Right 1176718838 21:10377366-10377388 CTCGGCCAACCCTTGAATTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176718838 Original CRISPR CTCGGCCAACCCTTGAATTT AGG Intergenic
No off target data available for this crispr