ID: 1176721412

View in Genome Browser
Species Human (GRCh38)
Location 21:10396801-10396823
Sequence AAAAAAAAGGAGAAGAAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176721407_1176721412 1 Left 1176721407 21:10396777-10396799 CCAACTCCGCGTTTCTTTTGGGG No data
Right 1176721412 21:10396801-10396823 AAAAAAAAGGAGAAGAAGGCTGG No data
1176721403_1176721412 26 Left 1176721403 21:10396752-10396774 CCCTTCAATGCTAATAAGTCTGT No data
Right 1176721412 21:10396801-10396823 AAAAAAAAGGAGAAGAAGGCTGG No data
1176721409_1176721412 -5 Left 1176721409 21:10396783-10396805 CCGCGTTTCTTTTGGGGAAAAAA No data
Right 1176721412 21:10396801-10396823 AAAAAAAAGGAGAAGAAGGCTGG No data
1176721404_1176721412 25 Left 1176721404 21:10396753-10396775 CCTTCAATGCTAATAAGTCTGTC No data
Right 1176721412 21:10396801-10396823 AAAAAAAAGGAGAAGAAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176721412 Original CRISPR AAAAAAAAGGAGAAGAAGGC TGG Intergenic
No off target data available for this crispr