ID: 1176722441

View in Genome Browser
Species Human (GRCh38)
Location 21:10403218-10403240
Sequence GAGCCTGCACACTGCGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176722437_1176722441 10 Left 1176722437 21:10403185-10403207 CCTAGGGACAGGAGGAGGGGAGT No data
Right 1176722441 21:10403218-10403240 GAGCCTGCACACTGCGTGGAAGG No data
1176722436_1176722441 11 Left 1176722436 21:10403184-10403206 CCCTAGGGACAGGAGGAGGGGAG No data
Right 1176722441 21:10403218-10403240 GAGCCTGCACACTGCGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176722441 Original CRISPR GAGCCTGCACACTGCGTGGA AGG Intergenic