ID: 1176724366

View in Genome Browser
Species Human (GRCh38)
Location 21:10417898-10417920
Sequence CTTTCAGCCATGATAGTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176724357_1176724366 24 Left 1176724357 21:10417851-10417873 CCATCCATGTCCTAGGTACAAGT No data
Right 1176724366 21:10417898-10417920 CTTTCAGCCATGATAGTGGGAGG No data
1176724358_1176724366 20 Left 1176724358 21:10417855-10417877 CCATGTCCTAGGTACAAGTGAGG No data
Right 1176724366 21:10417898-10417920 CTTTCAGCCATGATAGTGGGAGG No data
1176724361_1176724366 14 Left 1176724361 21:10417861-10417883 CCTAGGTACAAGTGAGGGTGAGA No data
Right 1176724366 21:10417898-10417920 CTTTCAGCCATGATAGTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176724366 Original CRISPR CTTTCAGCCATGATAGTGGG AGG Intergenic
No off target data available for this crispr