ID: 1176725181

View in Genome Browser
Species Human (GRCh38)
Location 21:10425902-10425924
Sequence CCTGTAGAGTTCCCGTAGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176725176_1176725181 23 Left 1176725176 21:10425856-10425878 CCTTTTTATTCTCGCAATTTATT No data
Right 1176725181 21:10425902-10425924 CCTGTAGAGTTCCCGTAGTCAGG No data
1176725175_1176725181 27 Left 1176725175 21:10425852-10425874 CCTTCCTTTTTATTCTCGCAATT No data
Right 1176725181 21:10425902-10425924 CCTGTAGAGTTCCCGTAGTCAGG No data
1176725174_1176725181 30 Left 1176725174 21:10425849-10425871 CCACCTTCCTTTTTATTCTCGCA No data
Right 1176725181 21:10425902-10425924 CCTGTAGAGTTCCCGTAGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176725181 Original CRISPR CCTGTAGAGTTCCCGTAGTC AGG Intergenic
No off target data available for this crispr