ID: 1176729064

View in Genome Browser
Species Human (GRCh38)
Location 21:10472019-10472041
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 242
Summary {0: 3, 1: 0, 2: 8, 3: 28, 4: 203}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176729064 Original CRISPR CTGTAGTCTTTCAATAAAGT GGG Intergenic
903751266 1:25622425-25622447 ATGTAGCCATTCATTAAAGTAGG - Intronic
906163198 1:43666430-43666452 CTGTACCCTTTCAATTAAATAGG + Exonic
906241566 1:44245342-44245364 TTGTAGTCTTTGAATGAAGAGGG - Intronic
911240213 1:95457094-95457116 CTAAAGACTTTCAATAAAATAGG + Intergenic
911568957 1:99498941-99498963 CTGTGGTCTTTAAAAAAAGGGGG + Intergenic
911756665 1:101565549-101565571 CTGTAGTGATTCAAGAAAGAGGG - Intergenic
911891155 1:103373597-103373619 CTGAAGCCTTTAATTAAAGTGGG - Intergenic
913423116 1:118695535-118695557 CTAAAATCTTTCAATAAATTAGG + Intergenic
915181809 1:154068177-154068199 CTGTAGCCTTGTAATATAGTTGG - Intronic
916308695 1:163369874-163369896 CTGTATTCTTACAGTGAAGTAGG - Intergenic
916699860 1:167280876-167280898 CTGTATTGTATCAATAAAGTAGG + Intronic
918482979 1:184999512-184999534 TTGTAGTATTTATATAAAGTAGG - Intergenic
918994582 1:191740420-191740442 CTCAATTCTTTCAATACAGTTGG + Intergenic
920604586 1:207368934-207368956 CTGTAGTTTTTTAATATATTTGG - Intergenic
921668063 1:217896151-217896173 CTGCATCCTTTCAATAATGTGGG + Intergenic
923113760 1:230914724-230914746 TTGTATTCTTACAGTAAAGTAGG - Intronic
1063097995 10:2925149-2925171 CTGCAGTGTTTCTACAAAGTAGG - Intergenic
1063856295 10:10257963-10257985 AGGTAGTCCTTCAGTAAAGTAGG - Intergenic
1065803321 10:29372378-29372400 CTGCAGTCTATCAATAAGGCAGG - Intergenic
1066812373 10:39356639-39356661 CTGAAATCTCTCAATAAATTAGG - Intergenic
1067393561 10:45888799-45888821 CTTTATTCTTACAATAAAGTTGG - Intergenic
1067861885 10:49857942-49857964 CTTTATTCTTACAATAAAGTTGG - Intronic
1068152256 10:53147559-53147581 CTATAATCTCTCAATAAACTAGG - Intergenic
1068208053 10:53883090-53883112 GTGTATTCTTTCAGTAAACTAGG - Intronic
1068921397 10:62488497-62488519 CTCTAGTCTTTAAATGAAGAGGG + Intronic
1072374098 10:94796392-94796414 CTGTAGCCTTGCAGTATAGTTGG + Intronic
1072832002 10:98668500-98668522 CTGTAGCCTTTTAGTGAAGTTGG - Intronic
1075064112 10:119277951-119277973 CTGTGGTCTATCGATACAGTGGG - Intronic
1077223713 11:1428576-1428598 CAGTGTCCTTTCAATAAAGTTGG + Intronic
1080366341 11:31578532-31578554 CTGTAGCCTTGCAGTATAGTTGG - Intronic
1081212071 11:40347964-40347986 CTGTTGTCTCTCAAGAAATTGGG + Intronic
1087414936 11:97842055-97842077 CCATATTCTTACAATAAAGTAGG + Intergenic
1091446974 12:549445-549467 CTGTAAGCGTTCAATAAATTAGG + Intronic
1091632794 12:2174799-2174821 GTGTATTCTTACAATAAAGTAGG + Intronic
1092397034 12:8135840-8135862 CAGAAGGCTTTCAATAAAATAGG + Intronic
1092642134 12:10524380-10524402 CTGTAGGCATTTCATAAAGTGGG + Intergenic
1093425153 12:19020325-19020347 CTCTGGTCTTTCCCTAAAGTAGG + Intergenic
1093457482 12:19379144-19379166 CTGTCATCTTTCTATAAACTGGG - Intergenic
1094858739 12:34434947-34434969 CTGAAAACTTTCAATAAATTAGG + Intergenic
1095530144 12:43177622-43177644 CTGTAATCCTGCAATTAAGTTGG + Intergenic
1096383393 12:51177991-51178013 TTGTATTCTTACAATAAAGTAGG - Intergenic
1097742711 12:63262882-63262904 CTAAAGACTTTGAATAAAGTGGG + Intergenic
1098523183 12:71456928-71456950 TTTTAGGGTTTCAATAAAGTGGG - Intronic
1099714066 12:86267619-86267641 CTGTAGTAATTCAATAAAGGGGG + Intronic
1101268175 12:103114173-103114195 TTAAAGTGTTTCAATAAAGTGGG + Intergenic
1103555765 12:121765650-121765672 CTGTAGTCCTTCTATTAGGTTGG - Intronic
1104531638 12:129576810-129576832 CTGTATTCTTAGAATCAAGTAGG + Intronic
1106526290 13:30543791-30543813 CTGTAAACTCTCAATAAGGTAGG - Intronic
1107838630 13:44433710-44433732 CTGAAGTCTTTCAATTGAGCTGG - Exonic
1108615713 13:52129663-52129685 CTGTAGTGTTTCGATTCAGTTGG - Intergenic
1109465240 13:62723225-62723247 CAGTAGACTTTCAGTAAAGCAGG + Intergenic
1109577959 13:64286636-64286658 CTTTAGTTTTTAAATAAATTAGG + Intergenic
1109921865 13:69074454-69074476 CTGTATTCTTATAATAAACTAGG + Intergenic
1110118938 13:71857312-71857334 CTGTTGTATTTCAGTAAAATAGG + Intronic
1110181343 13:72621104-72621126 CCCTATTCTTTCAAGAAAGTAGG - Intergenic
1110654315 13:77978789-77978811 GGGTAGTCTTTCAATAAATAGGG - Intergenic
1111532498 13:89557219-89557241 TTGCAGTGTTACAATAAAGTCGG + Intergenic
1111939258 13:94592373-94592395 CTGTAGTCTTTAAAATAAATTGG - Intronic
1112115335 13:96346182-96346204 CTTTACTCTCTCAATAAAGCAGG - Intronic
1112378676 13:98867763-98867785 CTGAAGTCCTTCATTGAAGTAGG - Intronic
1112771000 13:102794791-102794813 CTTTTGTCTTTCATTAAAATAGG - Intronic
1114817143 14:25972995-25973017 ATGTAGTCTGTGAATAAAGGTGG - Intergenic
1114892679 14:26944993-26945015 CTGTATTCTTCCACTAAATTTGG - Intergenic
1115236746 14:31215163-31215185 CTGTAGTATATCTATACAGTGGG - Intergenic
1116360305 14:43986692-43986714 CATTAGTCTTTCAACAAATTGGG + Intergenic
1116992546 14:51291597-51291619 CGTTAGGCTTTCAATAAATTTGG + Intergenic
1118829545 14:69417370-69417392 CTGTAGCCTTGTAATATAGTTGG + Intronic
1119680462 14:76588613-76588635 CAGTAGACTTTCAGTAAAGCAGG + Intergenic
1124465301 15:29933735-29933757 CTTTAGTCTTTCAGTATACTGGG - Intronic
1127101834 15:55573825-55573847 CTGTGTTCTTACAATAAAGTAGG + Intronic
1128132936 15:65242278-65242300 CTGTAGTCTTGAAATCAGGTAGG + Intronic
1130293851 15:82628861-82628883 CCGTATTCTTACGATAAAGTAGG - Intronic
1131919677 15:97310810-97310832 CTGTAGTCTTTCATAAAAATGGG - Intergenic
1137480163 16:48845894-48845916 CAGAGGTCTTTTAATAAAGTAGG + Intergenic
1138364128 16:56458956-56458978 CTGTAGTCTTTCTTCAAAGATGG + Intronic
1139007507 16:62591332-62591354 CTGTTGTCTTCCATTCAAGTAGG + Intergenic
1140996523 16:80265162-80265184 CTGTAGTATTTCTATTTAGTGGG - Intergenic
1141073760 16:80983120-80983142 TTGTATTCATGCAATAAAGTAGG - Intronic
1142934895 17:3320776-3320798 CTGTAGCCTTGCAGTATAGTTGG + Intergenic
1142937865 17:3351776-3351798 CTGTAGCCTTGCAGTATAGTTGG - Intergenic
1144116731 17:12101402-12101424 CTGAAGACTTTCTATAAAGCTGG - Intronic
1144353159 17:14418716-14418738 CTATATTCTTACAATAAAGTAGG - Intergenic
1148283672 17:46369347-46369369 CTGTAGACTTTGAGTAAAGAAGG - Intergenic
1148305890 17:46587264-46587286 CTGTAGACTTTGAGTAAAGAAGG - Intergenic
1151979677 17:77501209-77501231 CTGAACGCTTTCATTAAAGTGGG + Intergenic
1152936316 17:83139433-83139455 CTGTATTCATAAAATAAAGTGGG - Intergenic
1156085631 18:33397616-33397638 TTGTATTTTTTCAATAAACTGGG - Intronic
1156111465 18:33732445-33732467 CTGTAGTCTTTCAAGAAACTTGG - Intronic
1156932191 18:42659152-42659174 CTTTAGTCTTTCAGTAAAGTAGG + Intergenic
1157233308 18:45939656-45939678 CTGTAGTTTCTCCATAGAGTAGG + Exonic
1159268244 18:66112269-66112291 GTGTATTCTTACAATAAAGTAGG - Intergenic
1159650577 18:70972687-70972709 CTGGAGTCTTTACATAAAGTGGG + Intergenic
1159657091 18:71044064-71044086 CTGTAGACTTTGAGTAAAGCAGG + Intergenic
1160466379 18:79080802-79080824 CTGAAAACTCTCAATAAAGTAGG - Intronic
1161364936 19:3873131-3873153 CTGAAGTCTTTCAAATCAGTTGG + Intergenic
1202646859 1_KI270706v1_random:150174-150196 CTTTTGTATTTCTATAAAGTTGG - Intergenic
925734836 2:6954683-6954705 ATGTAGATTTTCAATTAAGTAGG + Intronic
926523904 2:13952273-13952295 CTGTAGCCTTGCAGTATAGTTGG - Intergenic
927365075 2:22285557-22285579 CTTTAGTCTTTCAAGAATATTGG - Intergenic
927814622 2:26203793-26203815 CTGTAGTCTTTGAATGCAGAAGG - Intronic
929221164 2:39466283-39466305 CTGTGTTTCTTCAATAAAGTGGG + Intergenic
931514191 2:63033099-63033121 CTGGAGTCCTGCAATAATGTTGG + Intronic
933386806 2:81621353-81621375 CTGTAGTTTCTCTTTAAAGTGGG - Intergenic
934082245 2:88478891-88478913 CTGTAGTATATCCATACAGTGGG - Intergenic
934986601 2:98891769-98891791 GTGAAAGCTTTCAATAAAGTTGG + Intronic
935507329 2:103921697-103921719 CAGTAGCCCTTCAATATAGTTGG + Intergenic
935530433 2:104226173-104226195 CTGTACTTTTTCATGAAAGTAGG - Intergenic
935550514 2:104448381-104448403 CCGTCTTCTTCCAATAAAGTGGG + Intergenic
936225090 2:110641741-110641763 CTTTAGTCTTTCCATCAACTGGG + Exonic
936393740 2:112101603-112101625 CTGTATTCTTACAATAAAGTAGG + Intronic
936496534 2:113027072-113027094 ATGTATTCTTACAATGAAGTAGG + Intronic
936657371 2:114504088-114504110 CTGTAGTCTTTCTATAACTTAGG + Intronic
937563196 2:123250333-123250355 CTGAAAACTTTCAATAAACTAGG + Intergenic
937630716 2:124098178-124098200 CTCTATTCTTACAATAAAGAAGG + Intronic
939660983 2:144889446-144889468 CTGTTGCCTTTCAAAACAGTGGG + Intergenic
940044776 2:149398202-149398224 CTGAAGTCTTTTAAAAAAGCAGG + Intronic
940952476 2:159691421-159691443 CTGTATTCTTACAATAAAGTAGG + Intergenic
942006708 2:171709409-171709431 CCATAGTATTTTAATAAAGTTGG - Intronic
942361260 2:175174147-175174169 CTGTATTCTTACAATAAAGGTGG + Intergenic
943109221 2:183585064-183585086 CTAAAGACTTTCAATAAACTAGG - Intergenic
943232625 2:185274740-185274762 ATGTAATCTTTCAAGAAAGGTGG + Intergenic
943539497 2:189194779-189194801 TTAAAATCTTTCAATAAAGTAGG - Intergenic
944342187 2:198614465-198614487 CTCTACTCTTTCAAGAAATTAGG + Intergenic
944366130 2:198921632-198921654 TTGTTGTTTTTCAATAAATTTGG - Intergenic
944717633 2:202391307-202391329 TTGTTGTTTTTCAATAAAATAGG + Intronic
947339262 2:229120329-229120351 CTATATTCTTGCAATAAAATAGG + Intronic
1170668837 20:18411318-18411340 CTTTTTTATTTCAATAAAGTTGG - Intronic
1174059549 20:47822916-47822938 CTGTATTCCTACAATAAAGTCGG - Intergenic
1174645726 20:52084024-52084046 CTGTTGTCTTACAATAAAAAAGG - Intronic
1174895514 20:54445571-54445593 TTCTAGTTTTTCAAGAAAGTTGG + Intergenic
1176729064 21:10472019-10472041 CTGTAGTCTTTCAATAAAGTGGG + Intergenic
1177333443 21:19692589-19692611 CTGAAGTTTTAAAATAAAGTGGG + Intergenic
1180377413 22:12107209-12107231 CTGTAGCCTTGTAATATAGTTGG + Intergenic
1182277345 22:29198968-29198990 CTGTATTCTCACAATAAAGTAGG + Intergenic
949355610 3:3177601-3177623 CTGTAGTAGAGCAATAAAGTGGG - Intronic
950147393 3:10661057-10661079 CTGAAAACTCTCAATAAAGTAGG + Intronic
950907435 3:16552153-16552175 CTATAGTCTTGCAAGAAGGTGGG + Intergenic
951568041 3:24031752-24031774 CTGTATTCTTACAATAAAGTAGG + Intergenic
952720625 3:36528882-36528904 TTGTAGTCTCTGAACAAAGTTGG - Exonic
952883612 3:38000075-38000097 CCCTAGTTTTTAAATAAAGTGGG + Intronic
953294908 3:41705064-41705086 CGATAGTCTTTCAATAAAATAGG + Exonic
957654370 3:83054681-83054703 CTGTAGGCTTGCAGTAAATTTGG - Intergenic
958156016 3:89756780-89756802 CTGTAGTCTTGTAGTATAGTTGG - Intergenic
958498576 3:94876063-94876085 CTCTAGGCTTTCAGTAAAGATGG + Intergenic
959373389 3:105558011-105558033 CTCTAGTTTTTCATTAAACTTGG + Intronic
965977658 3:174644311-174644333 CCATATTCTTACAATAAAGTTGG + Intronic
965978623 3:174657990-174658012 CTGTAGTATATCAAGAAAGTGGG - Intronic
967660695 3:192105828-192105850 ATGAAGGATTTCAATAAAGTAGG - Intergenic
967750310 3:193106909-193106931 TTGTAGTCTTTCAAGAACATAGG + Intergenic
969747508 4:9085266-9085288 CTGTAGCCTTGTAATATAGTTGG - Intergenic
969807544 4:9621859-9621881 CTAAAATCTCTCAATAAAGTAGG + Intergenic
969998033 4:11334753-11334775 CTGAAGTCTTTCAACAAACATGG - Intergenic
970154182 4:13124926-13124948 GAGGACTCTTTCAATAAAGTAGG - Intergenic
970162765 4:13205679-13205701 CAGTAGTCATTCAATAAATGTGG + Intergenic
970251333 4:14119187-14119209 CTGTATTCTTTCTAATAAGTAGG + Intergenic
971025247 4:22582980-22583002 CTGTATTCTTACAATAAATTAGG - Intergenic
972373109 4:38444973-38444995 CTAAAGACTCTCAATAAAGTAGG - Intergenic
974228112 4:59075106-59075128 CTTTATTCTTACAGTAAAGTAGG + Intergenic
974247740 4:59342682-59342704 CTGTAATCTTAAAATAGAGTGGG + Intergenic
974856075 4:67462619-67462641 CTGTATTCTCTGAATACAGTAGG + Intergenic
976195059 4:82523990-82524012 TTGTTGTGTTTTAATAAAGTAGG - Intronic
976920042 4:90428509-90428531 CTGTATTCTTATAATAAAGTAGG + Intronic
976989914 4:91353396-91353418 CTGTAATCTATGAATAACGTCGG + Intronic
981099106 4:140811207-140811229 CTGTGGACTTTGAATAAAGCAGG - Intergenic
981406393 4:144374721-144374743 GTGTAATCTTTCAGGAAAGTTGG - Intergenic
982703951 4:158687139-158687161 CTGAAGTCTGTCAATAAACTTGG - Intronic
984984397 4:185313872-185313894 CTGTACTGTTAGAATAAAGTAGG + Intronic
985351350 4:189066021-189066043 ATATTGTCTTTCAATATAGTGGG - Intergenic
1202759021 4_GL000008v2_random:92668-92690 CTGTAGCCTTGTAATATAGTTGG + Intergenic
986211136 5:5673690-5673712 TTGTTTTCTTTAAATAAAGTTGG + Intergenic
986226359 5:5818222-5818244 CTGTAATTTTTAAATAATGTTGG - Intergenic
986891590 5:12315308-12315330 CTGGAGTCATTCAAAAATGTTGG - Intergenic
987600173 5:20058012-20058034 CTTTATTCTCTCAATAAAGTGGG - Intronic
987664452 5:20919123-20919145 CTGTATTCTCACAATAAAGTAGG + Intergenic
988116380 5:26897628-26897650 CTATAAACTTTCAATAAACTAGG + Intronic
988758231 5:34283070-34283092 CTGTATTCTCACAATAAAGTAGG - Intergenic
989084655 5:37663078-37663100 CTGTATTGTTTCAAAAAAGCAGG - Intronic
989972806 5:50545021-50545043 CTGAAAACTTTCAATAAATTAGG + Intergenic
993517084 5:88851010-88851032 CTGCATTCTTACAAGAAAGTAGG - Intronic
996557606 5:124795290-124795312 CTGTATTCTTACAATGATGTAGG + Intergenic
996988369 5:129597367-129597389 CTGTATTTTTCCAATAAAATGGG - Intronic
998183766 5:139963433-139963455 CTGGAGTCTTTTGATAAAGAGGG + Intronic
999928080 5:156401387-156401409 CTGTATTCATTCAACAAGGTAGG + Intronic
1000665258 5:163987038-163987060 CTGTAGTGTTTCAATAACTGTGG + Intergenic
1004403788 6:15312787-15312809 CTGTAGTCTTTTTCTCAAGTGGG + Intronic
1005122564 6:22405889-22405911 CTGTATTCTTACAATAAAGTAGG + Intergenic
1005150006 6:22737846-22737868 CTGTAGCCTTCCAATGAAGGGGG - Intergenic
1006483406 6:34317351-34317373 CTGGAGGCTTTAAATACAGTAGG - Intronic
1007187985 6:39988612-39988634 CTGTATTCTTTCCATAACATAGG - Intergenic
1008663715 6:53695455-53695477 CTGTGGTGTTTGAATAGAGTTGG + Intergenic
1009622151 6:66091369-66091391 GTGTATTGTTTTAATAAAGTGGG - Intergenic
1010773521 6:79859745-79859767 CAGTAGACTTTGAATAAAGCAGG + Intergenic
1011570761 6:88731897-88731919 CTATATTCTTAAAATAAAGTAGG + Intronic
1012409173 6:98936645-98936667 CTGTATTCTTACAATGAAATAGG - Intronic
1013858946 6:114610290-114610312 CTGTAGTCATTCATTTAAATTGG + Intergenic
1016725331 6:147358696-147358718 CTGTATTCATGTAATAAAGTAGG + Intronic
1017731414 6:157320269-157320291 CTAAAGACTTTCAATTAAGTGGG + Intronic
1020514381 7:9097816-9097838 CTGAAGTCTTTGAAAAAGGTTGG + Intergenic
1021146107 7:17090750-17090772 CTTTAGTCTTTTAATAAAATAGG - Intergenic
1021254795 7:18377671-18377693 CTTTATTCTTTCAGTAAATTGGG + Intronic
1021764377 7:23932054-23932076 TTGTATTCTCACAATAAAGTAGG + Intergenic
1023463164 7:40422632-40422654 GTGTTGTCCTTAAATAAAGTAGG + Intronic
1026400462 7:70006719-70006741 CTGTAGCCTGTTAATAGAGTTGG + Intronic
1028755496 7:94428824-94428846 CAGTAGGCATTCAGTAAAGTTGG - Intronic
1029025521 7:97413187-97413209 CTGAAGTCTGTCAATACAGCTGG - Intergenic
1032849311 7:135780217-135780239 TTACAGACTTTCAATAAAGTTGG - Intergenic
1033628005 7:143130005-143130027 CTGTTGTTTTTCCAAAAAGTGGG + Intergenic
1033996504 7:147356245-147356267 CTGAAAACTCTCAATAAAGTAGG + Intronic
1034600525 7:152249577-152249599 CTGTAGTCTTTCAATAAAGTGGG - Intronic
1035202338 7:157275722-157275744 CTGTATTCTTACAATAAAGTGGG - Intergenic
1035883727 8:3269510-3269532 AAGTTATCTTTCAATAAAGTAGG + Intronic
1036657895 8:10689723-10689745 CTGTGTTCTTACAATAAAGTAGG + Intronic
1038794024 8:30693967-30693989 CAGCAGTCTGTCAATAAAGGGGG - Intronic
1038923804 8:32115406-32115428 CTATATTATTACAATAAAGTTGG + Intronic
1039368398 8:36958227-36958249 CTATTGTCTTTCATTAAATTTGG + Intergenic
1039733858 8:40308652-40308674 CTGTATTCTTACATTAAAGTAGG - Intergenic
1043949622 8:86293060-86293082 GTGTATTCTTACAATAAAGTGGG + Intronic
1045941611 8:107745491-107745513 CTGTAGGCTTTCAAATAAGATGG - Intergenic
1046278634 8:111995052-111995074 CTATTGTTTTTCAATAAAATGGG - Intergenic
1048822653 8:138394087-138394109 CTGTGGTCCTTCAGCAAAGTTGG + Intronic
1052103339 9:24478986-24479008 CTGCAGTCTTTCAAATACGTAGG - Intergenic
1052598345 9:30592095-30592117 ATGTAGACTTTGAAAAAAGTTGG + Intergenic
1054840118 9:69729459-69729481 CTGTAGCCCTTCAATAATGAGGG - Intronic
1055765321 9:79657018-79657040 CTGAAGTTTTTCAACAAAGGTGG + Intronic
1058601199 9:106672298-106672320 CTGTAGTCTTCCAAATATGTGGG - Intergenic
1058759290 9:108114673-108114695 CTGTATTTTTACAGTAAAGTAGG - Intergenic
1203539804 Un_KI270743v1:77567-77589 CTGTAGCCTTGTAATATAGTTGG + Intergenic
1203585188 Un_KI270746v1:62055-62077 CTGTAGTCTTTCAATAAAGTGGG - Intergenic
1186232514 X:7471259-7471281 CAGTGGTTTTTAAATAAAGTAGG - Intergenic
1186645419 X:11501694-11501716 CCGTATTCTTACAATAAAGTAGG + Intronic
1187246734 X:17559654-17559676 CTGCAGTCTTTCTCTAAAGATGG + Intronic
1188362183 X:29268689-29268711 CTGTAAGCTTAGAATAAAGTGGG + Intronic
1188536871 X:31206539-31206561 CTGTATTCTTTTATTAATGTTGG - Intronic
1191159226 X:57310522-57310544 GGGTATTCTTTTAATAAAGTTGG + Intronic
1192459844 X:71307691-71307713 CTACATTCTTACAATAAAGTAGG + Intergenic
1192662466 X:73056309-73056331 CTGAAAACTCTCAATAAAGTAGG + Intergenic
1194696577 X:97059641-97059663 CTGTATTCTTACAATAAAGTAGG + Intronic
1195284075 X:103366200-103366222 TTGGAGTTTTTCAATAAATTTGG + Intergenic
1196041734 X:111211979-111212001 CTGTTGTCTTTGCTTAAAGTCGG - Intronic
1196219684 X:113098177-113098199 CAGTAGACTTTGAGTAAAGTTGG - Intergenic
1198607766 X:138361873-138361895 CCTTAGCCTTTCAATAAAGAGGG - Intergenic
1198645890 X:138806260-138806282 CTAAAGTCTTTCAATAAGTTGGG - Intronic