ID: 1176733104

View in Genome Browser
Species Human (GRCh38)
Location 21:10519976-10519998
Sequence TAGGATACAAAACCACACCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176733104_1176733108 2 Left 1176733104 21:10519976-10519998 CCATGGTGTGGTTTTGTATCCTA No data
Right 1176733108 21:10520001-10520023 AGAGGGAGCCTGACTTATTTTGG No data
1176733104_1176733110 22 Left 1176733104 21:10519976-10519998 CCATGGTGTGGTTTTGTATCCTA No data
Right 1176733110 21:10520021-10520043 TGGAAAAGTAAAATTTTTTTTGG 0: 2
1: 0
2: 6
3: 87
4: 932

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176733104 Original CRISPR TAGGATACAAAACCACACCA TGG (reversed) Intergenic
No off target data available for this crispr