ID: 1176737111

View in Genome Browser
Species Human (GRCh38)
Location 21:10560503-10560525
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 3, 1: 3, 2: 0, 3: 17, 4: 188}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176737111_1176737114 29 Left 1176737111 21:10560503-10560525 CCATCACTCTGCTAGAAGCACCC 0: 3
1: 3
2: 0
3: 17
4: 188
Right 1176737114 21:10560555-10560577 ATGTCACTGATGAAAAATCTTGG 0: 5
1: 1
2: 0
3: 23
4: 283

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176737111 Original CRISPR GGGTGCTTCTAGCAGAGTGA TGG (reversed) Intronic
900232939 1:1571069-1571091 TGGTGCTTTTAGTAGAGTCAGGG - Intronic
904234947 1:29109493-29109515 GGGTCCTTCTTGCAGAGAGGTGG - Intronic
904322363 1:29706193-29706215 GGGGGCTTCCAGAAGGGTGAGGG - Intergenic
905306515 1:37022806-37022828 CAGTGCTTCTAGCACAGTGCAGG - Intronic
906055719 1:42915306-42915328 TCATGCTTCTAGCAGAGGGAGGG + Intergenic
906686265 1:47765372-47765394 GGGTGCATCCAGCAGAGGGGAGG + Exonic
908534511 1:65066180-65066202 GCGTGCGGGTAGCAGAGTGAGGG + Intergenic
910471806 1:87561416-87561438 GGGAGCTTCTTGTAGGGTGAGGG + Intergenic
911940713 1:104044098-104044120 GGGTGATGCTAGCTGAGTTAGGG + Intergenic
914455458 1:147832774-147832796 GGTAGCTTCTGTCAGAGTGAAGG + Intergenic
915287115 1:154860136-154860158 TGGTGCTCCAAGCAGGGTGAAGG + Intronic
918465314 1:184815818-184815840 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
919670021 1:200329779-200329801 GAGGGCTTCCAGCAGAGGGAGGG + Intergenic
920512642 1:206562250-206562272 GCCTGCTGCTAGCAGAGAGATGG - Intronic
920549053 1:206843028-206843050 GGGTGTTTCTGACAGAGGGATGG + Intergenic
922004652 1:221517522-221517544 TGGTGCTTCTGCCAGAATGATGG + Intergenic
922309279 1:224372975-224372997 GGGTGGATTTAGCACAGTGAAGG - Intronic
922903476 1:229156290-229156312 GGGTTGCTCTGGCAGAGTGAGGG - Intergenic
1067698464 10:48552217-48552239 GGGTGCTGGTTGGAGAGTGAGGG + Intronic
1070704075 10:78624884-78624906 GAGTCCCTCTAGCAAAGTGAGGG + Intergenic
1071305290 10:84294092-84294114 GGGTGCAGCAAGCAGGGTGAAGG - Intergenic
1075713915 10:124545021-124545043 GGGTGCTTTGAGCTGAGTGAAGG + Intronic
1076655957 10:132023553-132023575 GGGTGCCTCTGGGAGAGTAAGGG + Intergenic
1078145302 11:8718246-8718268 GGGTGTTTGCAGCAGAGGGAAGG - Intronic
1078311813 11:10251260-10251282 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
1082698362 11:56398723-56398745 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1082756162 11:57078618-57078640 GGGTGCTGCTACCAGAAGGAGGG + Intergenic
1083996826 11:66277023-66277045 AGGAGGTGCTAGCAGAGTGAGGG - Exonic
1084063930 11:66692736-66692758 GAGTGCTGCAAGAAGAGTGAGGG + Exonic
1084157433 11:67322003-67322025 GGGTGCACCTGGCAGAGTCAAGG - Intronic
1084359069 11:68657780-68657802 GGGTGCTTCCTGCCGAGTGGAGG - Intergenic
1084384949 11:68837682-68837704 GGGTGCTTCGGGCAGGGCGAGGG + Intronic
1086000845 11:81984889-81984911 GGGTAATTCAAGCAGAGAGATGG - Intergenic
1086393239 11:86387796-86387818 AGGTGCTTTTGGCAGAGGGAGGG + Intronic
1086486643 11:87310466-87310488 GGGGGCTTCTAGAGGAGGGAGGG + Intronic
1087226903 11:95611422-95611444 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1089952804 11:122546104-122546126 GGGAGCCTCTATCAGAGGGAAGG + Intergenic
1090292885 11:125561329-125561351 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1092977546 12:13759871-13759893 GAGTGCATGGAGCAGAGTGAGGG - Intronic
1094303399 12:28991309-28991331 GGGTGCCTCCAGCAGAATTATGG + Intergenic
1095673557 12:44890125-44890147 GGGAGGCTCTAGCAGAGTGACGG - Intronic
1096695127 12:53344303-53344325 GGGTTCTTCTGGGAGACTGAGGG - Intronic
1097254578 12:57663910-57663932 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1101189409 12:102315861-102315883 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1102041821 12:109805845-109805867 GGGGGCTTCTAGCATAGTCCAGG - Intronic
1103728191 12:123009395-123009417 GGGAGCTTCCAGCCCAGTGAGGG + Intronic
1104870579 12:131992461-131992483 GGGTGCATCTTGGAGAGTGTTGG + Intronic
1105336448 13:19474604-19474626 GGGTGCTTCTAGCATAGTGATGG + Intronic
1107489863 13:40870918-40870940 GGGTGCTTCTAGCACAGTGATGG + Intergenic
1108019511 13:46112470-46112492 GGGTGAGTGTAGCGGAGTGAGGG + Intergenic
1108631742 13:52290508-52290530 GGGCGATTCTAGTACAGTGATGG + Intergenic
1108654950 13:52522086-52522108 GGGCGATTCTAGTACAGTGATGG - Intergenic
1108704612 13:52973937-52973959 GGGTGCTGATAGGAGAGAGAAGG - Intergenic
1111094698 13:83497417-83497439 GATTGCATCTGGCAGAGTGAAGG + Intergenic
1118329187 14:64802505-64802527 GGGAGCATCTAGGAGAGAGAAGG - Intronic
1118329674 14:64805591-64805613 GGGAGCATCTAGGAGAGAGAAGG - Intronic
1118857873 14:69637987-69638009 GAGTTCTCCTAGCAGAGTGGTGG - Intronic
1119868369 14:77993056-77993078 GGGTGTTTCTCGCAGAGGGGGGG + Intergenic
1120821044 14:88912190-88912212 GTGTGCCTGGAGCAGAGTGATGG + Intergenic
1122549768 14:102543628-102543650 GGTTGCTTCATGAAGAGTGATGG - Intergenic
1122864265 14:104596448-104596470 GGAAGCTTCTGGCAGGGTGAGGG - Intronic
1124641820 15:31400629-31400651 TGGGGCTTCTAGCAGAGGGGTGG + Intronic
1127643448 15:60936632-60936654 GGATGGTTCTGCCAGAGTGACGG + Intronic
1128641630 15:69342655-69342677 GGGGCCTTCTGGCACAGTGATGG + Intronic
1129997753 15:80021470-80021492 TTGTGCTTCTAGCAGGGAGAGGG - Intergenic
1130890759 15:88132006-88132028 GGGCGCTTCTTGAAGAGTTATGG - Intronic
1134048780 16:11122164-11122186 GGGTGGTTCTCGCAGAGAGCAGG - Intronic
1134624273 16:15712823-15712845 GGAGGCTTCTGGGAGAGTGATGG + Intronic
1137626792 16:49914146-49914168 GGGTCCTTTTATCAGAGCGAGGG + Intergenic
1138689799 16:58756616-58756638 GGATGCTTCCTGCAGAATGATGG + Intergenic
1140585010 16:76278940-76278962 GGTTCCTTCTTTCAGAGTGATGG - Intronic
1141201746 16:81903617-81903639 GGATGCTTCCAGCACGGTGAAGG + Intronic
1141397209 16:83715843-83715865 GGGTGTTTTTACCAAAGTGAAGG + Intronic
1142638466 17:1271618-1271640 CGATGCTTTTAGGAGAGTGAGGG + Intergenic
1145228584 17:21152608-21152630 TTGTGCTTCCAGCAGAGGGAGGG + Intronic
1145880908 17:28352062-28352084 GGTTGCTAGTAGCAGAGTGAGGG - Intronic
1146448797 17:32955114-32955136 GGGTGTTGCAAGCAGAGGGAGGG - Intergenic
1146478434 17:33181883-33181905 GTGTGCTTGAAGCAGAGTGAGGG + Intronic
1148226120 17:45898948-45898970 GGGTGTTTCTGGGAGTGTGAGGG - Intronic
1148507285 17:48137792-48137814 GGGAGCTTACAGCAGAGTAATGG + Intronic
1150466504 17:65397416-65397438 GGGTGCTTCCAGTAGAATGCAGG - Intergenic
1151565740 17:74896844-74896866 GGGTGCAGATAGCAGAGGGAGGG + Intergenic
1151633775 17:75329564-75329586 GGGTGCTTATAACAGAGTTGTGG - Intronic
1152369431 17:79877344-79877366 GGGTGCTTCTAGGTGGGTGAAGG + Intergenic
1153537197 18:6115198-6115220 AGGTGCTTAAAGCAGAGTGGTGG + Intronic
1155287748 18:24308590-24308612 GGGTGGTACTAGCAAAGTGGGGG - Intronic
1156390476 18:36645506-36645528 GGGTGCCTCTAGCAGAAACAAGG - Intronic
1157598235 18:48876658-48876680 GGGTCCTTCCACCCGAGTGAGGG + Intergenic
1157675444 18:49565272-49565294 GGGTGCATCTAGCAGACTTGCGG - Intronic
1158131074 18:54153275-54153297 GCTTGCTTTTACCAGAGTGAGGG + Exonic
1161169606 19:2806244-2806266 GGGTCCTAGTGGCAGAGTGAGGG + Intronic
1162473359 19:10885613-10885635 GGGTGCCTCTTGCAGACTGAGGG + Intronic
1164399289 19:27891674-27891696 GGGTGCTTCTGCAAGAGTCATGG + Intergenic
1166644194 19:44519091-44519113 GGCTGCTTAGAGCAGAGTCAGGG - Intronic
1167520829 19:49953617-49953639 GGGTGCTCCGAGCAAAGTGTGGG + Intronic
925384721 2:3454190-3454212 GAGTGCTTTTTGCAGAGGGAGGG + Intronic
925392412 2:3505516-3505538 CTGTGCTTCTGGCAGAGGGAGGG + Intronic
925421610 2:3717426-3717448 GGGCGTTTCTGGGAGAGTGAAGG - Intronic
927589518 2:24341518-24341540 GTGTAGTTCTAGCACAGTGATGG + Intronic
928967646 2:36993113-36993135 GGCTGATTCTAGAACAGTGAGGG + Intronic
929061667 2:37930813-37930835 AGGAGGTGCTAGCAGAGTGAGGG + Intronic
929564150 2:42974410-42974432 GGCTGCTTCTTGCAGAGGTATGG + Intergenic
930399359 2:50863482-50863504 GTTTGATTTTAGCAGAGTGAAGG + Intronic
932076110 2:68664405-68664427 GTGTGCTTCCATCACAGTGAGGG + Intergenic
932270113 2:70401827-70401849 TGGTCCTTCTATCAGAGTTATGG - Intergenic
933077739 2:77950907-77950929 GTGCCCTTCTAGAAGAGTGAAGG + Intergenic
933522339 2:83389643-83389665 TGGTGGTTATAGCAGGGTGAGGG + Intergenic
933552740 2:83794733-83794755 GGCTGATTCTAACATAGTGAAGG + Intergenic
937009614 2:118550848-118550870 GGGTGTTCCCAGCAGGGTGATGG - Intergenic
937065290 2:119012693-119012715 GGCAGCTTCCAGCAGAGGGAAGG - Intergenic
937927359 2:127177365-127177387 GGGAGCTTCAGGCAGGGTGAGGG + Intergenic
939510573 2:143099544-143099566 GGGTACTTCTAAAAGAATGAGGG + Intronic
939833465 2:147100302-147100324 TGGTGCTGCTAGCAGAAGGATGG - Intergenic
946201830 2:218075154-218075176 GGGTGCATCTTGCAGACAGATGG - Exonic
947732204 2:232437485-232437507 GGGCCCTTCCAGCAGAGGGATGG + Intergenic
948566258 2:238888932-238888954 GGCTGATTCTAGCAGAGAGGAGG + Intronic
1169804270 20:9543355-9543377 GGGAGTTTATAGCACAGTGATGG - Intronic
1169908920 20:10631181-10631203 GGGCACTCCTAGCAGAGAGATGG + Intronic
1171721762 20:28570300-28570322 AAGTCCTTCTAGAAGAGTGAAGG - Intergenic
1171756299 20:29113199-29113221 AAGTCCTTCTAGAAGAGTGAAGG + Intergenic
1171785953 20:29464694-29464716 AAGTCCTTCTAGAAGAGTGAAGG - Intergenic
1171862288 20:30412278-30412300 AAGTCCTTCTAGAAGAGTGAAGG + Intergenic
1174405013 20:50297143-50297165 GGGTTCTTGTGGCAGAGTGCTGG + Intergenic
1175688327 20:61047415-61047437 GGGTGTTGCTACCAGATTGAAGG - Intergenic
1175757363 20:61538286-61538308 GTGTCCTTCTCCCAGAGTGACGG - Intronic
1176737111 21:10560503-10560525 GGGTGCTTCTAGCAGAGTGATGG - Intronic
1179341788 21:40518027-40518049 GGGTGCTTCATGCAGAGGGTGGG + Intronic
1180295318 22:10928987-10929009 AAGTCCTTCTAGAAGAGTGAAGG - Intergenic
1180413354 22:12637057-12637079 AAGTCCTTCTAGAAGAGTGAAGG + Intergenic
1180563109 22:16638025-16638047 GGGTGCTTCTAGCAGAGTGATGG - Intergenic
1183532017 22:38362101-38362123 GGGTGCTTCGAGCAGAGTGATGG + Intronic
1183664515 22:39239640-39239662 CGGGGTTTCTGGCAGAGTGAGGG + Intronic
951250336 3:20386953-20386975 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
958841733 3:99213344-99213366 GGTTTCTCCTAGAAGAGTGAGGG + Intergenic
959169862 3:102831154-102831176 GTGGGCTTCCACCAGAGTGATGG - Intergenic
959502498 3:107122643-107122665 GGGTGATTTTACCAGAGTGCAGG + Intergenic
961818768 3:129564661-129564683 GGGTCCTTCTGGCAGAGTGCAGG + Intronic
962280722 3:134049768-134049790 GGTGGCTACTAGCAGAGTCACGG - Intronic
962410751 3:135139978-135140000 TGGTACTCCTAGCAGAGTGAAGG - Intronic
963897464 3:150702604-150702626 GTGTGCTTCTAGCACAGCCACGG + Intronic
964155632 3:153581711-153581733 GGGGGCTGCAGGCAGAGTGAAGG - Intergenic
965969174 3:174532571-174532593 GGGTGCTTATAGAATAGTGAGGG + Intronic
966017914 3:175165864-175165886 GGGTGGATCAATCAGAGTGAAGG - Intronic
966536207 3:181037152-181037174 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
968744480 4:2352616-2352638 GGATGCTCCCAGCATAGTGAAGG - Intronic
969234373 4:5855328-5855350 TGGTGCTTCAAGGAGAGCGAGGG - Intronic
974854113 4:67438899-67438921 CTGTGCTTCTTGCAGAGGGAGGG + Intergenic
977740719 4:100478114-100478136 TGGTGCTTATAGGAGAATGAGGG - Intronic
983302711 4:165947714-165947736 GGGTGCTTCTAGAAATCTGAAGG + Intronic
983448467 4:167881491-167881513 GGCTGCTTCTAGCAGGATTAGGG - Intergenic
985393291 4:189514448-189514470 GGGTCCATCAAGCAGGGTGAAGG + Intergenic
986169326 5:5303208-5303230 GGCCGCTTCTATCAGAGTGATGG + Intronic
988502282 5:31793288-31793310 GGAAGCTCCTAGCAGAGTGGGGG + Intronic
989336791 5:40327096-40327118 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
990290870 5:54350119-54350141 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
990694248 5:58397502-58397524 GGGTTCTTTTATCAGATTGATGG - Intergenic
990993222 5:61705418-61705440 GAGTGCCTCTTGCTGAGTGATGG + Exonic
992223651 5:74597398-74597420 AGTTACTTCTAGCAGAGAGAAGG - Intergenic
992708218 5:79420368-79420390 GAGCGCTTCTGGCAGAGGGAGGG - Intronic
996202857 5:120698151-120698173 GGCTGCTTCGAGCAGGGTGAGGG + Intergenic
1000026549 5:157363717-157363739 GGGGGCTACTGGGAGAGTGAAGG + Intronic
1001435965 5:171699653-171699675 GGGTGCTTCTAGCATCTAGAGGG - Intergenic
1003111839 6:3257476-3257498 GGGTCCTCCTAGCTGATTGAAGG + Intronic
1005128882 6:22480096-22480118 TAGTGCTTCTAGCAGAGGGAGGG + Intergenic
1006902677 6:37513179-37513201 GGGTGCTGGTAGCACCGTGATGG - Intergenic
1006910822 6:37562455-37562477 GGGTGGTTCTAGGAGGGTGCTGG + Intergenic
1008547265 6:52594280-52594302 GGGTGCTTATAACACATTGAGGG - Intergenic
1008851915 6:56032739-56032761 TTGTGCTTCCAGCAGAGGGAGGG - Intergenic
1016260521 6:142164096-142164118 GGATGCTTCTAGCAGAAAGTAGG - Intronic
1017649039 6:156564428-156564450 TGGTGCTTCGAGTAGAGAGATGG - Intergenic
1018126837 6:160690590-160690612 GGATGCTTCTGGCAGGATGACGG + Intergenic
1019263082 7:93240-93262 GGATGCTTCCAGCAGTCTGAGGG - Intergenic
1020617855 7:10482214-10482236 GGTTGCTTCTCCCAGAGTTAGGG - Intergenic
1020714234 7:11649600-11649622 GGCTGCTTGAAGCAGACTGAAGG + Intronic
1024738704 7:52333140-52333162 GGCTGCTTCAAGCAGGATGAGGG + Intergenic
1028690571 7:93645013-93645035 GGCTGCTTCTAGCAGGATTAGGG - Intronic
1029810797 7:103046421-103046443 ATGTCCTTCTAGAAGAGTGAAGG + Intronic
1029882080 7:103824986-103825008 AGGTGGTTCTAGGAGAGTAAAGG + Intronic
1030066717 7:105665160-105665182 AGGTGCTGCTGGCAGAGTGATGG + Exonic
1032492453 7:132333638-132333660 GGGTGCTTCTACCAGAGGGCAGG + Intronic
1034470226 7:151250934-151250956 GGGTGCGTCTAGCAGGGGCATGG + Intronic
1036489709 8:9213764-9213786 TGGTTCTTTTAGCAGATTGATGG + Intergenic
1037764588 8:21764581-21764603 GGGTCCTTCTAACAGAGAGAAGG - Intronic
1039800781 8:40952640-40952662 GGGTCCTTCTAGGGGAGTGGGGG + Intergenic
1041319881 8:56602157-56602179 GGGTGCTTACAGCTGATTGATGG + Intergenic
1042078767 8:65026175-65026197 GGCTGCTAGTAGCAGAGTGCTGG - Intergenic
1044006773 8:86947063-86947085 GGTTGTTTCTAGTAGAGTGTGGG + Intronic
1044596224 8:93961350-93961372 GAATGCTTCTAGCAGGGAGAAGG + Intergenic
1044941883 8:97351862-97351884 GGATGAATCTAGCATAGTGAGGG + Intergenic
1046130020 8:109955245-109955267 GGGTGATGTTAGCAGAGAGATGG - Intergenic
1046684174 8:117206071-117206093 GGTAGCTTGGAGCAGAGTGATGG + Intergenic
1050658085 9:7851524-7851546 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
1051739597 9:20238639-20238661 GGCTGCTTCTAGCACTGTGAGGG + Intergenic
1055970596 9:81908193-81908215 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1058365712 9:104206144-104206166 TTGTGCTTCCAGCAGAGGGAGGG + Intergenic
1062116232 9:134810729-134810751 GGGAGCTGGTAGCAGAGTCATGG - Intronic
1202802194 9_KI270720v1_random:10091-10113 AAGTCCTTCTAGAAGAGTGAAGG - Intergenic
1203446753 Un_GL000219v1:63862-63884 AAGTCCTTCTAGAAGAGTGAAGG - Intergenic
1187123892 X:16435286-16435308 GGGGGCTTCTTGGAGAATGATGG + Intergenic
1188984375 X:36756254-36756276 GGGAGCTTCTAGCTGAGGGAAGG - Intergenic
1188987332 X:36779487-36779509 GGGTGCATCTAGCCTAGGGAAGG - Intergenic
1190652646 X:52582339-52582361 GGGTGCTTATAGTAGAAAGAAGG - Intergenic
1192265850 X:69537605-69537627 GGGTGGCTGTAGGAGAGTGAAGG - Intergenic
1193700632 X:84756300-84756322 TGCAGCTTCCAGCAGAGTGAAGG - Intergenic
1194003013 X:88455355-88455377 TGGTGCTTCTAGCAAAATGTGGG + Intergenic
1194766566 X:97848989-97849011 GGCTGCTTCCTGCTGAGTGAGGG - Intergenic
1195426325 X:104736016-104736038 GTGTGCTTCTAGAATAATGAAGG - Intronic
1200205344 X:154311603-154311625 GGGTTCTTCCAGAAGAGTGTGGG - Intronic
1201663770 Y:16426270-16426292 GGCTGCTCCTAGCAGTGTGCAGG + Intergenic
1201891162 Y:18945483-18945505 GGCTGCTTTTAGCAGAATTAGGG + Intergenic
1202595366 Y:26533767-26533789 GGGTGCTTCTAGCAGAGTGATGG - Intergenic