ID: 1176741391

View in Genome Browser
Species Human (GRCh38)
Location 21:10606723-10606745
Sequence GTATTAAGGCATGAGCCACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176741386_1176741391 -2 Left 1176741386 21:10606702-10606724 CCTCAGCCACCCAAAGTGCTGGT No data
Right 1176741391 21:10606723-10606745 GTATTAAGGCATGAGCCACCAGG No data
1176741384_1176741391 2 Left 1176741384 21:10606698-10606720 CCTGCCTCAGCCACCCAAAGTGC 0: 308
1: 61005
2: 178285
3: 231938
4: 272863
Right 1176741391 21:10606723-10606745 GTATTAAGGCATGAGCCACCAGG No data
1176741383_1176741391 21 Left 1176741383 21:10606679-10606701 CCTGAACTCAAGCAATCTGCCTG 0: 29
1: 718
2: 3770
3: 17789
4: 53897
Right 1176741391 21:10606723-10606745 GTATTAAGGCATGAGCCACCAGG No data
1176741387_1176741391 -8 Left 1176741387 21:10606708-10606730 CCACCCAAAGTGCTGGTATTAAG No data
Right 1176741391 21:10606723-10606745 GTATTAAGGCATGAGCCACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176741391 Original CRISPR GTATTAAGGCATGAGCCACC AGG Intergenic
No off target data available for this crispr