ID: 1176759714

View in Genome Browser
Species Human (GRCh38)
Location 21:10769737-10769759
Sequence ACAAAGAGAGTGTTCTGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176759708_1176759714 12 Left 1176759708 21:10769702-10769724 CCTGAAAGTGCTCCAAATGTCCA No data
Right 1176759714 21:10769737-10769759 ACAAAGAGAGTGTTCTGGGAGGG No data
1176759706_1176759714 22 Left 1176759706 21:10769692-10769714 CCACCATAGTCCTGAAAGTGCTC No data
Right 1176759714 21:10769737-10769759 ACAAAGAGAGTGTTCTGGGAGGG No data
1176759710_1176759714 -8 Left 1176759710 21:10769722-10769744 CCAATTGCAGATTCTACAAAGAG No data
Right 1176759714 21:10769737-10769759 ACAAAGAGAGTGTTCTGGGAGGG No data
1176759709_1176759714 0 Left 1176759709 21:10769714-10769736 CCAAATGTCCAATTGCAGATTCT No data
Right 1176759714 21:10769737-10769759 ACAAAGAGAGTGTTCTGGGAGGG No data
1176759707_1176759714 19 Left 1176759707 21:10769695-10769717 CCATAGTCCTGAAAGTGCTCCAA No data
Right 1176759714 21:10769737-10769759 ACAAAGAGAGTGTTCTGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176759714 Original CRISPR ACAAAGAGAGTGTTCTGGGA GGG Intergenic
No off target data available for this crispr