ID: 1176762610

View in Genome Browser
Species Human (GRCh38)
Location 21:12971059-12971081
Sequence CCTTCAGGAGAATCTGCAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 45655
Summary {0: 2, 1: 3, 2: 503, 3: 7463, 4: 37684}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176762610 Original CRISPR CCTTCAGGAGAATCTGCAAG TGG (reversed) Intergenic
Too many off-targets to display for this crispr