ID: 1176764620

View in Genome Browser
Species Human (GRCh38)
Location 21:13003878-13003900
Sequence ATGGGTAAATCATCTGAGGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176764620_1176764622 -8 Left 1176764620 21:13003878-13003900 CCGACCTCAGATGATTTACCCAT No data
Right 1176764622 21:13003893-13003915 TTACCCATCTCAGCCTCCCAAGG No data
1176764620_1176764626 -1 Left 1176764620 21:13003878-13003900 CCGACCTCAGATGATTTACCCAT No data
Right 1176764626 21:13003900-13003922 TCTCAGCCTCCCAAGGTGCTGGG 0: 79
1: 7041
2: 117363
3: 345517
4: 455733
1176764620_1176764625 -2 Left 1176764620 21:13003878-13003900 CCGACCTCAGATGATTTACCCAT No data
Right 1176764625 21:13003899-13003921 ATCTCAGCCTCCCAAGGTGCTGG 0: 41
1: 2733
2: 41991
3: 167483
4: 365929
1176764620_1176764630 26 Left 1176764620 21:13003878-13003900 CCGACCTCAGATGATTTACCCAT No data
Right 1176764630 21:13003927-13003949 CAAGCGTGAGCCACCATGCCTGG 0: 297
1: 9349
2: 48477
3: 123868
4: 181339

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176764620 Original CRISPR ATGGGTAAATCATCTGAGGT CGG (reversed) Intergenic
No off target data available for this crispr