ID: 1176767663

View in Genome Browser
Species Human (GRCh38)
Location 21:13037120-13037142
Sequence CTGGGCACTGTGCAGTCGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176767663_1176767671 21 Left 1176767663 21:13037120-13037142 CCTGGCGACTGCACAGTGCCCAG No data
Right 1176767671 21:13037164-13037186 GGCGCGAGCCAAGGAAGAGCAGG 0: 8
1: 2
2: 2
3: 16
4: 228
1176767663_1176767666 -1 Left 1176767663 21:13037120-13037142 CCTGGCGACTGCACAGTGCCCAG No data
Right 1176767666 21:13037142-13037164 GAGCCTGCAAACCAGCGCTCAGG No data
1176767663_1176767670 12 Left 1176767663 21:13037120-13037142 CCTGGCGACTGCACAGTGCCCAG No data
Right 1176767670 21:13037155-13037177 AGCGCTCAGGGCGCGAGCCAAGG No data
1176767663_1176767667 0 Left 1176767663 21:13037120-13037142 CCTGGCGACTGCACAGTGCCCAG No data
Right 1176767667 21:13037143-13037165 AGCCTGCAAACCAGCGCTCAGGG No data
1176767663_1176767672 22 Left 1176767663 21:13037120-13037142 CCTGGCGACTGCACAGTGCCCAG No data
Right 1176767672 21:13037165-13037187 GCGCGAGCCAAGGAAGAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176767663 Original CRISPR CTGGGCACTGTGCAGTCGCC AGG (reversed) Intergenic