ID: 1176767665

View in Genome Browser
Species Human (GRCh38)
Location 21:13037139-13037161
Sequence GAGCGCTGGTTTGCAGGCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176767665_1176767670 -7 Left 1176767665 21:13037139-13037161 CCAGAGCCTGCAAACCAGCGCTC No data
Right 1176767670 21:13037155-13037177 AGCGCTCAGGGCGCGAGCCAAGG No data
1176767665_1176767675 14 Left 1176767665 21:13037139-13037161 CCAGAGCCTGCAAACCAGCGCTC No data
Right 1176767675 21:13037176-13037198 GGAAGAGCAGGGCCTAGAGTGGG No data
1176767665_1176767676 17 Left 1176767665 21:13037139-13037161 CCAGAGCCTGCAAACCAGCGCTC No data
Right 1176767676 21:13037179-13037201 AGAGCAGGGCCTAGAGTGGGAGG No data
1176767665_1176767672 3 Left 1176767665 21:13037139-13037161 CCAGAGCCTGCAAACCAGCGCTC No data
Right 1176767672 21:13037165-13037187 GCGCGAGCCAAGGAAGAGCAGGG No data
1176767665_1176767674 13 Left 1176767665 21:13037139-13037161 CCAGAGCCTGCAAACCAGCGCTC No data
Right 1176767674 21:13037175-13037197 AGGAAGAGCAGGGCCTAGAGTGG No data
1176767665_1176767677 18 Left 1176767665 21:13037139-13037161 CCAGAGCCTGCAAACCAGCGCTC No data
Right 1176767677 21:13037180-13037202 GAGCAGGGCCTAGAGTGGGAGGG No data
1176767665_1176767671 2 Left 1176767665 21:13037139-13037161 CCAGAGCCTGCAAACCAGCGCTC No data
Right 1176767671 21:13037164-13037186 GGCGCGAGCCAAGGAAGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176767665 Original CRISPR GAGCGCTGGTTTGCAGGCTC TGG (reversed) Intergenic
No off target data available for this crispr