ID: 1176767666

View in Genome Browser
Species Human (GRCh38)
Location 21:13037142-13037164
Sequence GAGCCTGCAAACCAGCGCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176767662_1176767666 5 Left 1176767662 21:13037114-13037136 CCGCATCCTGGCGACTGCACAGT No data
Right 1176767666 21:13037142-13037164 GAGCCTGCAAACCAGCGCTCAGG No data
1176767663_1176767666 -1 Left 1176767663 21:13037120-13037142 CCTGGCGACTGCACAGTGCCCAG No data
Right 1176767666 21:13037142-13037164 GAGCCTGCAAACCAGCGCTCAGG No data
1176767660_1176767666 17 Left 1176767660 21:13037102-13037124 CCTGCTGCTCAGCCGCATCCTGG No data
Right 1176767666 21:13037142-13037164 GAGCCTGCAAACCAGCGCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176767666 Original CRISPR GAGCCTGCAAACCAGCGCTC AGG Intergenic
No off target data available for this crispr