ID: 1176767670

View in Genome Browser
Species Human (GRCh38)
Location 21:13037155-13037177
Sequence AGCGCTCAGGGCGCGAGCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176767663_1176767670 12 Left 1176767663 21:13037120-13037142 CCTGGCGACTGCACAGTGCCCAG No data
Right 1176767670 21:13037155-13037177 AGCGCTCAGGGCGCGAGCCAAGG No data
1176767665_1176767670 -7 Left 1176767665 21:13037139-13037161 CCAGAGCCTGCAAACCAGCGCTC No data
Right 1176767670 21:13037155-13037177 AGCGCTCAGGGCGCGAGCCAAGG No data
1176767660_1176767670 30 Left 1176767660 21:13037102-13037124 CCTGCTGCTCAGCCGCATCCTGG No data
Right 1176767670 21:13037155-13037177 AGCGCTCAGGGCGCGAGCCAAGG No data
1176767664_1176767670 -6 Left 1176767664 21:13037138-13037160 CCCAGAGCCTGCAAACCAGCGCT No data
Right 1176767670 21:13037155-13037177 AGCGCTCAGGGCGCGAGCCAAGG No data
1176767662_1176767670 18 Left 1176767662 21:13037114-13037136 CCGCATCCTGGCGACTGCACAGT No data
Right 1176767670 21:13037155-13037177 AGCGCTCAGGGCGCGAGCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176767670 Original CRISPR AGCGCTCAGGGCGCGAGCCA AGG Intergenic
No off target data available for this crispr