ID: 1176767671

View in Genome Browser
Species Human (GRCh38)
Location 21:13037164-13037186
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176767663_1176767671 21 Left 1176767663 21:13037120-13037142 CCTGGCGACTGCACAGTGCCCAG No data
Right 1176767671 21:13037164-13037186 GGCGCGAGCCAAGGAAGAGCAGG No data
1176767665_1176767671 2 Left 1176767665 21:13037139-13037161 CCAGAGCCTGCAAACCAGCGCTC No data
Right 1176767671 21:13037164-13037186 GGCGCGAGCCAAGGAAGAGCAGG No data
1176767668_1176767671 -4 Left 1176767668 21:13037145-13037167 CCTGCAAACCAGCGCTCAGGGCG No data
Right 1176767671 21:13037164-13037186 GGCGCGAGCCAAGGAAGAGCAGG No data
1176767662_1176767671 27 Left 1176767662 21:13037114-13037136 CCGCATCCTGGCGACTGCACAGT No data
Right 1176767671 21:13037164-13037186 GGCGCGAGCCAAGGAAGAGCAGG No data
1176767664_1176767671 3 Left 1176767664 21:13037138-13037160 CCCAGAGCCTGCAAACCAGCGCT No data
Right 1176767671 21:13037164-13037186 GGCGCGAGCCAAGGAAGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176767671 Original CRISPR GGCGCGAGCCAAGGAAGAGC AGG Intergenic
No off target data available for this crispr