ID: 1176767674

View in Genome Browser
Species Human (GRCh38)
Location 21:13037175-13037197
Sequence AGGAAGAGCAGGGCCTAGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176767665_1176767674 13 Left 1176767665 21:13037139-13037161 CCAGAGCCTGCAAACCAGCGCTC No data
Right 1176767674 21:13037175-13037197 AGGAAGAGCAGGGCCTAGAGTGG No data
1176767668_1176767674 7 Left 1176767668 21:13037145-13037167 CCTGCAAACCAGCGCTCAGGGCG No data
Right 1176767674 21:13037175-13037197 AGGAAGAGCAGGGCCTAGAGTGG No data
1176767664_1176767674 14 Left 1176767664 21:13037138-13037160 CCCAGAGCCTGCAAACCAGCGCT No data
Right 1176767674 21:13037175-13037197 AGGAAGAGCAGGGCCTAGAGTGG No data
1176767669_1176767674 -1 Left 1176767669 21:13037153-13037175 CCAGCGCTCAGGGCGCGAGCCAA No data
Right 1176767674 21:13037175-13037197 AGGAAGAGCAGGGCCTAGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176767674 Original CRISPR AGGAAGAGCAGGGCCTAGAG TGG Intergenic
No off target data available for this crispr