ID: 1176767677

View in Genome Browser
Species Human (GRCh38)
Location 21:13037180-13037202
Sequence GAGCAGGGCCTAGAGTGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176767669_1176767677 4 Left 1176767669 21:13037153-13037175 CCAGCGCTCAGGGCGCGAGCCAA No data
Right 1176767677 21:13037180-13037202 GAGCAGGGCCTAGAGTGGGAGGG No data
1176767668_1176767677 12 Left 1176767668 21:13037145-13037167 CCTGCAAACCAGCGCTCAGGGCG No data
Right 1176767677 21:13037180-13037202 GAGCAGGGCCTAGAGTGGGAGGG No data
1176767664_1176767677 19 Left 1176767664 21:13037138-13037160 CCCAGAGCCTGCAAACCAGCGCT No data
Right 1176767677 21:13037180-13037202 GAGCAGGGCCTAGAGTGGGAGGG No data
1176767665_1176767677 18 Left 1176767665 21:13037139-13037161 CCAGAGCCTGCAAACCAGCGCTC No data
Right 1176767677 21:13037180-13037202 GAGCAGGGCCTAGAGTGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176767677 Original CRISPR GAGCAGGGCCTAGAGTGGGA GGG Intergenic
No off target data available for this crispr