ID: 1176769580

View in Genome Browser
Species Human (GRCh38)
Location 21:13057025-13057047
Sequence ACCTAGGAGAAACTCCCTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176769577_1176769580 -3 Left 1176769577 21:13057005-13057027 CCATACAAAGGTCTGACCAGACC 0: 40
1: 82
2: 96
3: 77
4: 128
Right 1176769580 21:13057025-13057047 ACCTAGGAGAAACTCCCTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176769580 Original CRISPR ACCTAGGAGAAACTCCCTTC AGG Intergenic
No off target data available for this crispr