ID: 1176804006

View in Genome Browser
Species Human (GRCh38)
Location 21:13462624-13462646
Sequence CTCTATCTGATGAGAGTTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176804006_1176804013 24 Left 1176804006 21:13462624-13462646 CCTGAAACTCTCATCAGATAGAG No data
Right 1176804013 21:13462671-13462693 AGTGTTATTTCAATAACATTGGG No data
1176804006_1176804012 23 Left 1176804006 21:13462624-13462646 CCTGAAACTCTCATCAGATAGAG No data
Right 1176804012 21:13462670-13462692 TAGTGTTATTTCAATAACATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176804006 Original CRISPR CTCTATCTGATGAGAGTTTC AGG (reversed) Intergenic
No off target data available for this crispr