ID: 1176804124

View in Genome Browser
Species Human (GRCh38)
Location 21:13463720-13463742
Sequence GAACTGGTGTGGATCCCAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176804113_1176804124 21 Left 1176804113 21:13463676-13463698 CCACGGAGAACAGAGAGGAGTGA No data
Right 1176804124 21:13463720-13463742 GAACTGGTGTGGATCCCAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176804124 Original CRISPR GAACTGGTGTGGATCCCAGG GGG Intergenic
No off target data available for this crispr