ID: 1176808471

View in Genome Browser
Species Human (GRCh38)
Location 21:13515011-13515033
Sequence TCCAGCTGGCCAGGAACTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176808467_1176808471 -7 Left 1176808467 21:13514995-13515017 CCGGCCTCTGGCTAGGTCCAGCT No data
Right 1176808471 21:13515011-13515033 TCCAGCTGGCCAGGAACTGCTGG No data
1176808464_1176808471 5 Left 1176808464 21:13514983-13515005 CCTTTGCTGAAACCGGCCTCTGG No data
Right 1176808471 21:13515011-13515033 TCCAGCTGGCCAGGAACTGCTGG No data
1176808462_1176808471 24 Left 1176808462 21:13514964-13514986 CCTGGGGTGGGTGTGACTGCCTT No data
Right 1176808471 21:13515011-13515033 TCCAGCTGGCCAGGAACTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176808471 Original CRISPR TCCAGCTGGCCAGGAACTGC TGG Intergenic
No off target data available for this crispr