ID: 1176808582

View in Genome Browser
Species Human (GRCh38)
Location 21:13515525-13515547
Sequence TGCCCCCAACCAGCCCTTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176808573_1176808582 18 Left 1176808573 21:13515484-13515506 CCAAACTGCCCCACTGCCTCCAG No data
Right 1176808582 21:13515525-13515547 TGCCCCCAACCAGCCCTTGCTGG No data
1176808580_1176808582 -1 Left 1176808580 21:13515503-13515525 CCAGCAGTGCAGCCAGGGATAGT No data
Right 1176808582 21:13515525-13515547 TGCCCCCAACCAGCCCTTGCTGG No data
1176808579_1176808582 2 Left 1176808579 21:13515500-13515522 CCTCCAGCAGTGCAGCCAGGGAT No data
Right 1176808582 21:13515525-13515547 TGCCCCCAACCAGCCCTTGCTGG No data
1176808576_1176808582 8 Left 1176808576 21:13515494-13515516 CCACTGCCTCCAGCAGTGCAGCC No data
Right 1176808582 21:13515525-13515547 TGCCCCCAACCAGCCCTTGCTGG No data
1176808575_1176808582 9 Left 1176808575 21:13515493-13515515 CCCACTGCCTCCAGCAGTGCAGC No data
Right 1176808582 21:13515525-13515547 TGCCCCCAACCAGCCCTTGCTGG No data
1176808570_1176808582 21 Left 1176808570 21:13515481-13515503 CCCCCAAACTGCCCCACTGCCTC No data
Right 1176808582 21:13515525-13515547 TGCCCCCAACCAGCCCTTGCTGG No data
1176808571_1176808582 20 Left 1176808571 21:13515482-13515504 CCCCAAACTGCCCCACTGCCTCC No data
Right 1176808582 21:13515525-13515547 TGCCCCCAACCAGCCCTTGCTGG No data
1176808572_1176808582 19 Left 1176808572 21:13515483-13515505 CCCAAACTGCCCCACTGCCTCCA No data
Right 1176808582 21:13515525-13515547 TGCCCCCAACCAGCCCTTGCTGG No data
1176808574_1176808582 10 Left 1176808574 21:13515492-13515514 CCCCACTGCCTCCAGCAGTGCAG No data
Right 1176808582 21:13515525-13515547 TGCCCCCAACCAGCCCTTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176808582 Original CRISPR TGCCCCCAACCAGCCCTTGC TGG Intergenic