ID: 1176809322

View in Genome Browser
Species Human (GRCh38)
Location 21:13520807-13520829
Sequence CTCCCAGACCAGCACATCGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176809315_1176809322 20 Left 1176809315 21:13520764-13520786 CCCTGTGGCCACTGCAGCTGATG No data
Right 1176809322 21:13520807-13520829 CTCCCAGACCAGCACATCGTTGG No data
1176809317_1176809322 12 Left 1176809317 21:13520772-13520794 CCACTGCAGCTGATGTCACATAG No data
Right 1176809322 21:13520807-13520829 CTCCCAGACCAGCACATCGTTGG No data
1176809316_1176809322 19 Left 1176809316 21:13520765-13520787 CCTGTGGCCACTGCAGCTGATGT No data
Right 1176809322 21:13520807-13520829 CTCCCAGACCAGCACATCGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176809322 Original CRISPR CTCCCAGACCAGCACATCGT TGG Intergenic
No off target data available for this crispr