ID: 1176814955

View in Genome Browser
Species Human (GRCh38)
Location 21:13590744-13590766
Sequence TTGAATAAGAATGGTGAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176814955_1176814962 12 Left 1176814955 21:13590744-13590766 CCTTTCTCACCATTCTTATTCAA No data
Right 1176814962 21:13590779-13590801 AGTTCTGGCCAGGGCAATCAGGG 0: 55
1: 62
2: 39
3: 75
4: 262
1176814955_1176814958 -3 Left 1176814955 21:13590744-13590766 CCTTTCTCACCATTCTTATTCAA No data
Right 1176814958 21:13590764-13590786 CAACACAGCATTGGAAGTTCTGG 0: 18
1: 307
2: 2748
3: 11203
4: 3881
1176814955_1176814959 2 Left 1176814955 21:13590744-13590766 CCTTTCTCACCATTCTTATTCAA No data
Right 1176814959 21:13590769-13590791 CAGCATTGGAAGTTCTGGCCAGG 0: 14
1: 283
2: 2688
3: 10939
4: 3690
1176814955_1176814960 3 Left 1176814955 21:13590744-13590766 CCTTTCTCACCATTCTTATTCAA No data
Right 1176814960 21:13590770-13590792 AGCATTGGAAGTTCTGGCCAGGG 0: 67
1: 2203
2: 10932
3: 3695
4: 1407
1176814955_1176814961 11 Left 1176814955 21:13590744-13590766 CCTTTCTCACCATTCTTATTCAA No data
Right 1176814961 21:13590778-13590800 AAGTTCTGGCCAGGGCAATCAGG 0: 6624
1: 7821
2: 3183
3: 2190
4: 2951

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176814955 Original CRISPR TTGAATAAGAATGGTGAGAA AGG (reversed) Intergenic
No off target data available for this crispr