ID: 1176822833

View in Genome Browser
Species Human (GRCh38)
Location 21:13676017-13676039
Sequence GCGCAGCAGGAACGCCATGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 2, 2: 3, 3: 10, 4: 93}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176822833_1176822836 2 Left 1176822833 21:13676017-13676039 CCATCATGGCGTTCCTGCTGCGC 0: 1
1: 2
2: 3
3: 10
4: 93
Right 1176822836 21:13676042-13676064 CGTGCTCCTGTGCGGAGTCGCGG No data
1176822833_1176822835 -6 Left 1176822833 21:13676017-13676039 CCATCATGGCGTTCCTGCTGCGC 0: 1
1: 2
2: 3
3: 10
4: 93
Right 1176822835 21:13676034-13676056 CTGCGCTTCGTGCTCCTGTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176822833 Original CRISPR GCGCAGCAGGAACGCCATGA TGG (reversed) Intergenic
900001742 1:18267-18289 GGGCAGCAAGAAGGCCATCAAGG - Intergenic
900021462 1:188790-188812 GGGCAGCAAGAAGGCCATCAAGG - Intergenic
901040180 1:6358828-6358850 GCTCAGCTGGAAAGCCATGGTGG + Intronic
902228106 1:15009391-15009413 GAGCACCAGGAAGGCCAGGAGGG + Intronic
902923006 1:19678626-19678648 GCACAGCAGGAAGGCCCTGAAGG + Exonic
903315889 1:22506448-22506470 GAGCCACAGGAACACCATGAGGG - Intronic
903555061 1:24187242-24187264 CCGCGGCAGGAAGGCCATGGCGG - Exonic
912552148 1:110491352-110491374 GCACAGCAGGAACTACATGGTGG + Intergenic
913598045 1:120396379-120396401 GGGCAGCAGCAACTCCAAGAGGG + Intergenic
914089284 1:144482941-144482963 GGGCAGCAGCAACTCCAAGAGGG - Intergenic
914309327 1:146451274-146451296 GGGCAGCAGCAACTCCAAGAGGG + Intergenic
914592784 1:149121863-149121885 GGGCAGCAGCAACTCCAAGAGGG - Intergenic
921158591 1:212456926-212456948 GCACAGCAGAAACACCATGATGG + Intergenic
922550871 1:226493401-226493423 GCGCAGGATGAATTCCATGAGGG + Intergenic
1062932859 10:1363973-1363995 GCACAGCAGGCACTCCCTGAGGG + Intronic
1069915981 10:71787095-71787117 GGGCAACAGGAAGGCCTTGAAGG + Intronic
1073505766 10:103987899-103987921 GCCCAGCAGGGACGCTAAGAGGG - Intronic
1075788758 10:125068531-125068553 GGGCAGCAGGAAGGCCAGGAAGG + Intronic
1078570006 11:12449541-12449563 GAGCAGCAGTAAGTCCATGAAGG - Intronic
1091178510 11:133582234-133582256 GCGCAGCAGGAAACCCGTGCGGG - Intergenic
1091335102 11:134760537-134760559 GCACAGCAGGAAGGTCATGGAGG + Intergenic
1091374820 12:18372-18394 GGGCAGCAAGAAGGCCATCAAGG - Intergenic
1097153456 12:56995877-56995899 GGGCAGCAGGAAGCCCAGGATGG - Exonic
1097275160 12:57808131-57808153 CCCCAGCAGGACAGCCATGAAGG + Intronic
1099143803 12:79013411-79013433 GGGCACCAGGAACTCCAAGAGGG + Intronic
1121261620 14:92570273-92570295 GCTCAGCAGGAAGGCCCTGGGGG + Intronic
1123493956 15:20804788-20804810 GCGCAGCAGGAGCGCCATGGTGG + Intergenic
1123550455 15:21373870-21373892 GCGCAGCAGGAGCGCCACGGTGG + Intergenic
1131264351 15:90906788-90906810 GCGCAGCAGGTAAGGCATGGTGG - Exonic
1132451769 15:101972673-101972695 GGGCAGCAAGAAGGCCATCAAGG + Intergenic
1202958798 15_KI270727v1_random:101124-101146 GCGCAGCAGGAGCGCCATGGTGG + Intergenic
1132455123 16:17956-17978 GGGCAGCAAGAAGGCCATCAAGG - Exonic
1135533593 16:23275519-23275541 GAGCAGAAGGCAAGCCATGATGG + Intergenic
1135989646 16:27210185-27210207 GTGCGGCAGGAGCGCCCTGAGGG - Exonic
1136548655 16:30969763-30969785 GCCCAGCAGGAAGGTCATGTGGG - Intronic
1142553075 17:752621-752643 GCGCGGCAGGAGCGCGTTGAGGG - Intronic
1146579313 17:34022783-34022805 GAGCTGCAGGAAAGCTATGAGGG - Intronic
1148994833 17:51700563-51700585 GAGCAGATGGAAGGCCATGAGGG - Intronic
1152887359 17:82860291-82860313 GCGCAGCGTGACCGCCATGCAGG - Intronic
1154173768 18:12068403-12068425 GAGCAGCACGTACGCCAAGAGGG - Intergenic
1154451477 18:14479250-14479272 GCGCAGCAGGAGCGCCATGGTGG + Intergenic
1155774142 18:29737688-29737710 GCACAGCAGCAAAGCAATGAAGG + Intergenic
1160603652 18:80033522-80033544 GCGCAGCAGCAAAGCCCTGGAGG + Intronic
1160607908 18:80066117-80066139 GGGCAGCAGGACCCCGATGAGGG + Intronic
1162391590 19:10393339-10393361 GCGCATCGAGAAGGCCATGAAGG - Exonic
1164645775 19:29858088-29858110 GCGCAGCAGGAAGTCCAGGTGGG + Intergenic
1167564646 19:50248783-50248805 GCGCACCAGGTACTACATGACGG - Intronic
1168270117 19:55245313-55245335 GCGCAGCAGGAGGTCCATGATGG + Exonic
927902035 2:26827383-26827405 GCGCAGCATGAATTCCATGCGGG + Intergenic
931831240 2:66053631-66053653 ACTCAGCATGAACACCATGAGGG - Intergenic
932000533 2:67880501-67880523 CCGCAGCCGGAAAGCCAGGATGG + Intergenic
934553520 2:95276093-95276115 CAGCAGCAGGAAGACCATGAGGG - Exonic
934620368 2:95799777-95799799 GAGCAGCAGCGTCGCCATGATGG - Intergenic
936567980 2:113595140-113595162 GGGCAGCAAGAAGGCCATCAAGG + Intergenic
938288698 2:130138271-130138293 GCTCAGCAGGAATGCCGTGAGGG - Intergenic
938448979 2:131399769-131399791 CCGAAGCAGGAAAGCCATGCTGG - Intergenic
938467835 2:131534661-131534683 GCTCAGCAGGAATGCCGTGAGGG + Intergenic
943782052 2:191836011-191836033 GCACAGAAGGTACGCTATGAGGG - Exonic
946422903 2:219575000-219575022 GCGCAGCAGCAGCACCAGGACGG - Exonic
947025636 2:225734881-225734903 GGGCAGCAGGTACTCCCTGAGGG + Intergenic
948164578 2:235851253-235851275 GAGCAGCAGGAGCGCCAGGTGGG - Intronic
1168819914 20:765757-765779 GTGCATCAGGAAGGCCATGGCGG + Exonic
1176444667 21:6810979-6811001 GCGCAGCAGGAACGCCATGGTGG - Intergenic
1176822833 21:13676017-13676039 GCGCAGCAGGAACGCCATGATGG - Intergenic
1177157383 21:17513125-17513147 GCACAGCAGGAGCGCCATGGTGG - Exonic
1177262517 21:18749299-18749321 GAGCAGCAGGAAGGCAAAGAGGG + Intergenic
1179962983 21:44781307-44781329 ACCCAGCAGGAAGGGCATGAGGG + Intronic
1179967742 21:44817084-44817106 GCACACCAGGGACGCGATGATGG + Intronic
1180801149 22:18632529-18632551 GACCAGCAGGGATGCCATGAGGG + Intergenic
1180852379 22:19028088-19028110 GACCAGCAGGGATGCCATGAGGG + Intergenic
1181108265 22:20587285-20587307 GCTCAGCAGGAATGCCGTGAGGG - Exonic
1181220571 22:21362732-21362754 GACCAGCAGGGATGCCATGAGGG - Intergenic
1183228203 22:36564485-36564507 GCTCAGCAGGGACCCCCTGAAGG - Exonic
1183314849 22:37131307-37131329 GCGGAGGAGGAAAGCCATGCCGG - Intronic
1183401860 22:37609334-37609356 GGGCTCCAGGAACGCCATGCAGG - Intronic
1184232245 22:43164547-43164569 GAGCATCGGGAAAGCCATGAGGG - Intergenic
953793658 3:45966986-45967008 GCGCAGCTGGAAGTCCATCAGGG - Exonic
954301820 3:49704343-49704365 GACCAGCAGGAAGGGCATGATGG + Intronic
956958741 3:74373309-74373331 GAGCAGCAGGAAGACCCTGAAGG - Intronic
968807644 4:2786242-2786264 GCACAGCAGGTACTCCAGGAGGG + Intergenic
970004685 4:11399466-11399488 GCGCACCAGGAACTCCTCGATGG + Exonic
973014366 4:45119039-45119061 GAGCAGGAGGAACAGCATGAGGG + Intergenic
997870620 5:137502423-137502445 GGGGAGCAGGAAAGCCAGGAGGG - Intronic
999232187 5:150068248-150068270 CAGCAGCAGCAAGGCCATGATGG + Exonic
1000097856 5:157986833-157986855 GCCCATCAAGAAGGCCATGAAGG - Intergenic
1002062111 5:176631268-176631290 GCGCAGCTGGAGAGCCAGGATGG + Intronic
1011971904 6:93235991-93236013 GGGAAGCAGGAACGCCCTGAGGG - Intergenic
1022591926 7:31671687-31671709 GCACAGCAGGAATGCCAGCATGG - Intergenic
1029733141 7:102450800-102450822 GAGCTGCAGAAACGCCTTGAAGG + Exonic
1037998693 8:23371796-23371818 GCGCAGCACGAAAGGCAGGAAGG + Intronic
1041031420 8:53739786-53739808 GCACACCAGGAATGCCATGGTGG + Intronic
1044552960 8:93532567-93532589 GAACAGCAGGAAGGGCATGAGGG - Intergenic
1044595597 8:93955547-93955569 GCGGAGGAGGAACAGCATGAGGG - Intergenic
1049709811 8:144058413-144058435 GGGCAGCAGGCGGGCCATGAGGG + Intronic
1049749523 8:144276695-144276717 GCTCGGCAGGAGCGCCATGTGGG - Intronic
1049884550 9:18380-18402 GGGCAGCAAGAAGGCCATCAAGG - Intergenic
1056795897 9:89658701-89658723 GTGCAGCAGGCATGGCATGAGGG - Intergenic
1060560712 9:124540373-124540395 GAGCAGGAGGAAGGCCACGAAGG - Intronic
1062344688 9:136109366-136109388 GGGCAGCAGGAGGGCCATGCAGG - Intergenic
1062658758 9:137617721-137617743 GCGGGGCAGGAGGGCCATGAAGG + Intronic
1062694395 9:137865925-137865947 CCGCAGCATGGACACCATGAAGG + Intronic
1203524531 Un_GL000213v1:73548-73570 GCGCAGCAGGAACGCCATGGTGG + Intergenic
1203701238 Un_GL000214v1:135612-135634 GCGCAGCGGGAACCCCCTGCTGG - Intergenic
1192233208 X:69279829-69279851 AGGCAGCAGGAACAGCATGAGGG - Intergenic
1198300743 X:135332117-135332139 GAGCAGCAGGTAGGCCAAGAAGG + Intronic
1200093828 X:153648087-153648109 GCGCAGCAGGAGCGCCGGCAGGG - Exonic
1200401256 X:156021771-156021793 GGGCAGCAAGAAGGCCATCAAGG + Intergenic
1201767832 Y:17589198-17589220 GCCTAGCAGGTAGGCCATGAGGG + Intergenic
1201833721 Y:18316787-18316809 GCCTAGCAGGTAGGCCATGAGGG - Intergenic