ID: 1176823284

View in Genome Browser
Species Human (GRCh38)
Location 21:13680354-13680376
Sequence GTCCTCCCGTGCCATAGTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176823275_1176823284 28 Left 1176823275 21:13680303-13680325 CCTCCGTGTAGGAGTCCTCCGGT No data
Right 1176823284 21:13680354-13680376 GTCCTCCCGTGCCATAGTGTAGG No data
1176823283_1176823284 -3 Left 1176823283 21:13680334-13680356 CCAGAGCACAGTGAGGCTGGGTC No data
Right 1176823284 21:13680354-13680376 GTCCTCCCGTGCCATAGTGTAGG No data
1176823276_1176823284 25 Left 1176823276 21:13680306-13680328 CCGTGTAGGAGTCCTCCGGTGCT No data
Right 1176823284 21:13680354-13680376 GTCCTCCCGTGCCATAGTGTAGG No data
1176823278_1176823284 13 Left 1176823278 21:13680318-13680340 CCTCCGGTGCTGGAGTCCAGAGC No data
Right 1176823284 21:13680354-13680376 GTCCTCCCGTGCCATAGTGTAGG No data
1176823279_1176823284 10 Left 1176823279 21:13680321-13680343 CCGGTGCTGGAGTCCAGAGCACA No data
Right 1176823284 21:13680354-13680376 GTCCTCCCGTGCCATAGTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176823284 Original CRISPR GTCCTCCCGTGCCATAGTGT AGG Intergenic
No off target data available for this crispr