ID: 1176834507

View in Genome Browser
Species Human (GRCh38)
Location 21:13780641-13780663
Sequence AGGAATAGGGAGAAAGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176834507_1176834513 18 Left 1176834507 21:13780641-13780663 CCTGCCTCTTTCTCCCTATTCCT No data
Right 1176834513 21:13780682-13780704 TTTGCATTGTCTTTGCTGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176834507 Original CRISPR AGGAATAGGGAGAAAGAGGC AGG (reversed) Intergenic
No off target data available for this crispr