ID: 1176834580

View in Genome Browser
Species Human (GRCh38)
Location 21:13781237-13781259
Sequence TCACTGAAGCAGCTCTTGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176834572_1176834580 19 Left 1176834572 21:13781195-13781217 CCTGGCCAGGCAGTGATGTGGCA No data
Right 1176834580 21:13781237-13781259 TCACTGAAGCAGCTCTTGCTGGG No data
1176834567_1176834580 25 Left 1176834567 21:13781189-13781211 CCCCCACCTGGCCAGGCAGTGAT No data
Right 1176834580 21:13781237-13781259 TCACTGAAGCAGCTCTTGCTGGG No data
1176834569_1176834580 23 Left 1176834569 21:13781191-13781213 CCCACCTGGCCAGGCAGTGATGT No data
Right 1176834580 21:13781237-13781259 TCACTGAAGCAGCTCTTGCTGGG No data
1176834566_1176834580 28 Left 1176834566 21:13781186-13781208 CCACCCCCACCTGGCCAGGCAGT No data
Right 1176834580 21:13781237-13781259 TCACTGAAGCAGCTCTTGCTGGG No data
1176834570_1176834580 22 Left 1176834570 21:13781192-13781214 CCACCTGGCCAGGCAGTGATGTG No data
Right 1176834580 21:13781237-13781259 TCACTGAAGCAGCTCTTGCTGGG No data
1176834574_1176834580 14 Left 1176834574 21:13781200-13781222 CCAGGCAGTGATGTGGCAGTGGC No data
Right 1176834580 21:13781237-13781259 TCACTGAAGCAGCTCTTGCTGGG No data
1176834568_1176834580 24 Left 1176834568 21:13781190-13781212 CCCCACCTGGCCAGGCAGTGATG No data
Right 1176834580 21:13781237-13781259 TCACTGAAGCAGCTCTTGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176834580 Original CRISPR TCACTGAAGCAGCTCTTGCT GGG Intergenic
No off target data available for this crispr