ID: 1176835995

View in Genome Browser
Species Human (GRCh38)
Location 21:13793864-13793886
Sequence CTCTGGGGACGGAGAGCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176835977_1176835995 24 Left 1176835977 21:13793817-13793839 CCCTCGCCCTACCCAGCTGCTCC No data
Right 1176835995 21:13793864-13793886 CTCTGGGGACGGAGAGCAGAGGG No data
1176835986_1176835995 -3 Left 1176835986 21:13793844-13793866 CCAGGCAGCCCACTGCCTTGCTC No data
Right 1176835995 21:13793864-13793886 CTCTGGGGACGGAGAGCAGAGGG No data
1176835978_1176835995 23 Left 1176835978 21:13793818-13793840 CCTCGCCCTACCCAGCTGCTCCA No data
Right 1176835995 21:13793864-13793886 CTCTGGGGACGGAGAGCAGAGGG No data
1176835982_1176835995 13 Left 1176835982 21:13793828-13793850 CCCAGCTGCTCCAAACCCAGGCA No data
Right 1176835995 21:13793864-13793886 CTCTGGGGACGGAGAGCAGAGGG No data
1176835980_1176835995 17 Left 1176835980 21:13793824-13793846 CCTACCCAGCTGCTCCAAACCCA No data
Right 1176835995 21:13793864-13793886 CTCTGGGGACGGAGAGCAGAGGG No data
1176835984_1176835995 3 Left 1176835984 21:13793838-13793860 CCAAACCCAGGCAGCCCACTGCC No data
Right 1176835995 21:13793864-13793886 CTCTGGGGACGGAGAGCAGAGGG No data
1176835983_1176835995 12 Left 1176835983 21:13793829-13793851 CCAGCTGCTCCAAACCCAGGCAG No data
Right 1176835995 21:13793864-13793886 CTCTGGGGACGGAGAGCAGAGGG No data
1176835979_1176835995 18 Left 1176835979 21:13793823-13793845 CCCTACCCAGCTGCTCCAAACCC No data
Right 1176835995 21:13793864-13793886 CTCTGGGGACGGAGAGCAGAGGG No data
1176835985_1176835995 -2 Left 1176835985 21:13793843-13793865 CCCAGGCAGCCCACTGCCTTGCT No data
Right 1176835995 21:13793864-13793886 CTCTGGGGACGGAGAGCAGAGGG No data
1176835976_1176835995 30 Left 1176835976 21:13793811-13793833 CCATTGCCCTCGCCCTACCCAGC No data
Right 1176835995 21:13793864-13793886 CTCTGGGGACGGAGAGCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176835995 Original CRISPR CTCTGGGGACGGAGAGCAGA GGG Intergenic
No off target data available for this crispr