ID: 1176837211

View in Genome Browser
Species Human (GRCh38)
Location 21:13804307-13804329
Sequence GGATCTCTCCTGAAAACTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176837211_1176837214 5 Left 1176837211 21:13804307-13804329 CCACCAGTTTTCAGGAGAGATCC No data
Right 1176837214 21:13804335-13804357 AGTTTCAATTAAGCTAAACACGG No data
1176837211_1176837216 11 Left 1176837211 21:13804307-13804329 CCACCAGTTTTCAGGAGAGATCC No data
Right 1176837216 21:13804341-13804363 AATTAAGCTAAACACGGCAAGGG No data
1176837211_1176837215 10 Left 1176837211 21:13804307-13804329 CCACCAGTTTTCAGGAGAGATCC No data
Right 1176837215 21:13804340-13804362 CAATTAAGCTAAACACGGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176837211 Original CRISPR GGATCTCTCCTGAAAACTGG TGG (reversed) Intergenic
No off target data available for this crispr