ID: 1176837454

View in Genome Browser
Species Human (GRCh38)
Location 21:13806824-13806846
Sequence GAAACACTAATTTCGCTGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176837454_1176837455 -4 Left 1176837454 21:13806824-13806846 CCAGTCAGCGAAATTAGTGTTTC No data
Right 1176837455 21:13806843-13806865 TTTCTACAGCTGAAATAATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176837454 Original CRISPR GAAACACTAATTTCGCTGAC TGG (reversed) Intergenic
No off target data available for this crispr