ID: 1176838242

View in Genome Browser
Species Human (GRCh38)
Location 21:13815026-13815048
Sequence TCTTCCAGGCTGAAAGTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176838234_1176838242 20 Left 1176838234 21:13814983-13815005 CCCATTACGAAGCTGATTTGTCA No data
Right 1176838242 21:13815026-13815048 TCTTCCAGGCTGAAAGTGGGAGG No data
1176838235_1176838242 19 Left 1176838235 21:13814984-13815006 CCATTACGAAGCTGATTTGTCAC No data
Right 1176838242 21:13815026-13815048 TCTTCCAGGCTGAAAGTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176838242 Original CRISPR TCTTCCAGGCTGAAAGTGGG AGG Intergenic
No off target data available for this crispr