ID: 1176843187

View in Genome Browser
Species Human (GRCh38)
Location 21:13856699-13856721
Sequence AAGATGCACAGCTACAGCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176843187_1176843192 3 Left 1176843187 21:13856699-13856721 CCCAAGCTGTAGCTGTGCATCTT No data
Right 1176843192 21:13856725-13856747 ATCATGGCTGGAGCTGGAGCTGG No data
1176843187_1176843194 15 Left 1176843187 21:13856699-13856721 CCCAAGCTGTAGCTGTGCATCTT No data
Right 1176843194 21:13856737-13856759 GCTGGAGCTGGAGCTGGAGATGG No data
1176843187_1176843193 9 Left 1176843187 21:13856699-13856721 CCCAAGCTGTAGCTGTGCATCTT No data
Right 1176843193 21:13856731-13856753 GCTGGAGCTGGAGCTGGAGCTGG 0: 28
1: 32
2: 99
3: 589
4: 2021
1176843187_1176843191 -3 Left 1176843187 21:13856699-13856721 CCCAAGCTGTAGCTGTGCATCTT No data
Right 1176843191 21:13856719-13856741 CTTTCAATCATGGCTGGAGCTGG No data
1176843187_1176843196 27 Left 1176843187 21:13856699-13856721 CCCAAGCTGTAGCTGTGCATCTT No data
Right 1176843196 21:13856749-13856771 GCTGGAGATGGAGCTGGAGATGG No data
1176843187_1176843195 21 Left 1176843187 21:13856699-13856721 CCCAAGCTGTAGCTGTGCATCTT No data
Right 1176843195 21:13856743-13856765 GCTGGAGCTGGAGATGGAGCTGG No data
1176843187_1176843190 -9 Left 1176843187 21:13856699-13856721 CCCAAGCTGTAGCTGTGCATCTT No data
Right 1176843190 21:13856713-13856735 GTGCATCTTTCAATCATGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176843187 Original CRISPR AAGATGCACAGCTACAGCTT GGG (reversed) Intergenic
No off target data available for this crispr