ID: 1176843585

View in Genome Browser
Species Human (GRCh38)
Location 21:13859538-13859560
Sequence CTAAAATTCCACATGAATAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176843573_1176843585 10 Left 1176843573 21:13859505-13859527 CCTCCCACCAGTTCCCACCTTTA No data
Right 1176843585 21:13859538-13859560 CTAAAATTCCACATGAATATTGG No data
1176843577_1176843585 -3 Left 1176843577 21:13859518-13859540 CCCACCTTTAACATTCCCCCCTA No data
Right 1176843585 21:13859538-13859560 CTAAAATTCCACATGAATATTGG No data
1176843574_1176843585 7 Left 1176843574 21:13859508-13859530 CCCACCAGTTCCCACCTTTAACA No data
Right 1176843585 21:13859538-13859560 CTAAAATTCCACATGAATATTGG No data
1176843578_1176843585 -4 Left 1176843578 21:13859519-13859541 CCACCTTTAACATTCCCCCCTAA No data
Right 1176843585 21:13859538-13859560 CTAAAATTCCACATGAATATTGG No data
1176843575_1176843585 6 Left 1176843575 21:13859509-13859531 CCACCAGTTCCCACCTTTAACAT No data
Right 1176843585 21:13859538-13859560 CTAAAATTCCACATGAATATTGG No data
1176843579_1176843585 -7 Left 1176843579 21:13859522-13859544 CCTTTAACATTCCCCCCTAAAAT No data
Right 1176843585 21:13859538-13859560 CTAAAATTCCACATGAATATTGG No data
1176843576_1176843585 3 Left 1176843576 21:13859512-13859534 CCAGTTCCCACCTTTAACATTCC No data
Right 1176843585 21:13859538-13859560 CTAAAATTCCACATGAATATTGG No data
1176843572_1176843585 24 Left 1176843572 21:13859491-13859513 CCATGATTAAATCACCTCCCACC No data
Right 1176843585 21:13859538-13859560 CTAAAATTCCACATGAATATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176843585 Original CRISPR CTAAAATTCCACATGAATAT TGG Intergenic
No off target data available for this crispr