ID: 1176845875

View in Genome Browser
Species Human (GRCh38)
Location 21:13876045-13876067
Sequence AAGATGCACAGCTACAGCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176845875_1176845880 3 Left 1176845875 21:13876045-13876067 CCCAAGCTGTAGCTGTGCATCTT No data
Right 1176845880 21:13876071-13876093 GTCATGGCTGGAGCTGGAGCTGG No data
1176845875_1176845884 25 Left 1176845875 21:13876045-13876067 CCCAAGCTGTAGCTGTGCATCTT No data
Right 1176845884 21:13876093-13876115 GAGCTGGAGCTGGAGCTGCAGGG 0: 19
1: 19
2: 47
3: 227
4: 1074
1176845875_1176845878 -9 Left 1176845875 21:13876045-13876067 CCCAAGCTGTAGCTGTGCATCTT No data
Right 1176845878 21:13876059-13876081 GTGCATCTTTCAGTCATGGCTGG No data
1176845875_1176845881 9 Left 1176845875 21:13876045-13876067 CCCAAGCTGTAGCTGTGCATCTT No data
Right 1176845881 21:13876077-13876099 GCTGGAGCTGGAGCTGGAGCTGG 0: 28
1: 32
2: 99
3: 589
4: 2021
1176845875_1176845882 15 Left 1176845875 21:13876045-13876067 CCCAAGCTGTAGCTGTGCATCTT No data
Right 1176845882 21:13876083-13876105 GCTGGAGCTGGAGCTGGAGCTGG 0: 28
1: 32
2: 99
3: 589
4: 2021
1176845875_1176845883 24 Left 1176845875 21:13876045-13876067 CCCAAGCTGTAGCTGTGCATCTT No data
Right 1176845883 21:13876092-13876114 GGAGCTGGAGCTGGAGCTGCAGG 0: 22
1: 26
2: 68
3: 356
4: 1762
1176845875_1176845879 -3 Left 1176845875 21:13876045-13876067 CCCAAGCTGTAGCTGTGCATCTT No data
Right 1176845879 21:13876065-13876087 CTTTCAGTCATGGCTGGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176845875 Original CRISPR AAGATGCACAGCTACAGCTT GGG (reversed) Intergenic
No off target data available for this crispr